Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1046  (registered. 2012)
Contig Information
Length 858 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 2
WH_XI Two-week old seedlings(22℃ 16L-8D) 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222632396|gb|EEE64528.1|| hypothetical protein OsJ_19379 [Oryza sativa Japonica Group]
Score 418
Evalue 4.00E-115
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig1046
ACCGGACACTGAACAGATCTTGATCTACTGCACTCTAGGCTTCTAGCCAAATCTAATAGACACTTCTACCAAGCAGGTTATAGCATTTCCGTCCCATGCT
GCAAAACTTCCCACGGGACCAACAACAAAAAAAAGTTCTAAGCATATTTGCATCTGTTGGTTGTGTACCATCTCCCGCCCCCACTGTCCAGAGTCCGGGC
TATTTGTCCCAGCCATCTTCTCGCCTGCCAAACTCCCATTTCTGTGGCAGAGGGCCATATATGGAGGAGAACTTGGCCAGGCACTTGGTCCTGACGTCGT
AGTGCTTCTGCGTGTCGCGGCTGATGGCGACGGAGGAGAGCTTGGAGGTGTCGATGGCCCATGCCGGGTGCACGTACTCCACCGTCCTCCCCCCGGCGCC
GGAGCTCGCGTTCGCGTACATGAAGTTCATCAGCAGGTCCTCGCAGTTGAAGTTCTTGTGCACGTAGTCCCTCCCTTCCCTGGCCTCCTCGCTCCAGTAC
CTCCTGAAGGCAAACTCACTGTCCATGAATGCGGCACCGGTGAGGATCAGGTTGTAGCCCTTCTTGCCCCTGGCGTACCGCTCGTTCCTGTACTGCGGGG
GGTCGCCGTCGATCATCCGCGGGTAGAAGCCGACCATCCGCTCGGGGTGCTCCCTCCACACCTTGAACCCTTTCTCTACGTCGCTGCAGGTCATCATGAT
GTCATCATCCAGCTCGAGGACGGCCCGGGTCTTTATCAGAGGGTCGACTCTGAACCTGTTGTTGAGAGAGTTGAGCTCCTCCACTCGTATCCTGACAGGC
ACCGTGGAGTCGAAGGCATCGCTGCCAGGAGGGTTGCCTTTGTTCCAGACGACAACTA
page-top