Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10452  (registered. 2012)
Contig Information
Length 1254 bp
Clones alternative view 33 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 1
Wh_CSEC Callus 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_OKCS Seed DPA5 3
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 3
WH_XN Leaves, plant was grown at constant 23 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 4
WH_SP 7
WH_XA Root 1
WH_XB Root 1
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|219885633|gb|ACL53191.1|| unknown [Zea mays]
Score 592
Evalue 4.00E-167
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig10452
TTTTTTTTTTGGTCATTTTTTTTGTGTTCAAATCGGCACACAGTATCAGCAACAAGTGCTAAAACAACTGGCTTGCACAAAGTATAAGCTTGATTGCTAC
AAGCAGCATAATCCACTGGATGATTTAGATTAATATATTACTTAGACGTGACGTGACCCATAATCCACTGATGTTCCACGAATGTTTACTCCACGGAATA
ACCCTGACCACTCGGACCAAAACAATAACCACCACAACCCAGTCTCAGATAACGATAGGGCACGACATAATAATAACTAAGCAGCAGGTCTCTGCCACAG
AACATCGACTAGCTTAGTCGACCTCCTCAATCTTGGGGCCAGCGCCGCCGGATGCAGCCGGGGTGTCGTCATCCATGCCGCCCTCCATGTCGGCGCCAGC
ACCCTGGTACATCTTGGCGATGATGGGGTTGCACAGGGCCTCCAGCTCCTTCATCTTGTCCTCGAACTCGTCCGCCTCAGCGAGCTGGTTCGTGTCCAGC
CACTGGATGGCAGCATCGATGGCGTCCTCGATCTTCTTCTTGTCGTCTGCCGGCAGCTTGGAGGCGATCTTCTCGTCCTTGATGGTGTTGCGCATGTTGT
ACGAGTAGTTCTCCAGGGCGTTCTTAGACTCCACCTTCTTCTTGTGCTCCTCGTCCTCAGACTTGTACTTCTCAGCCTCCTGGACCATCTTCTCGATCTC
CTCCTTGCTCAGCCTACCCTTGTCGTTGGTGATGGTGATCTTGTTCTTCTGCCCAGTCGTCTTGTCCTCGGCAGACACGTTCAGGATACCATTGGCGTCG
ATGTCAAAGCAGACAGTGATCTGGGGAACTCCCCTGGGTGCAGGAGGGATGCCAGACAGCTCAAACTTGCCAAGGAGGTTGTTGTCACGGGTCCTGGTCC
TCTCACCCTCATACACCTGGATGAGCACACCAGGCTGGTTGTCCGAGTAGGTGGAGAAGACCTGCTCCTTCTTGGTGGGGATGGTTGTGTTCCTTGGGAT
CAAGACTGTCATTACACCTCCAGCCGTCTCCAGACCAAGAGAAAGAGGAGTGACATCCAATAGCAGCAGGTCCTGGACCTTCTCGTTGCCCTCACCGCTC
AAGATGGCAGCCTGGACGGCAGCTCCGTAGGCAACAGCCTCATCAGGGTTGATGCTCTTGCAGAGCTCCTTGCCGTTGAAGAAGTCCTGAAGAAGCTGCT
GCACTCTGGGAATCCTAGTGGAACCACCAACAAGGACAACATCGTGCACGGTGC
page-top