Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig9325  (registered. 2007)
Contig Information
Length 1341 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_OKCS Seed DPA5 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_033561 [Oryza sativa (japonica cultivar-group)]
Score 112
Evalue 0.00229479
Total Hit Count 12
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig9325
AGACTGCACTTCAGAATGTCCGTGTCATCATCTTTGACGTGAGAGGCGGAGGGCAAGAATTGCGCTCTATGGTCAATAGAAGGATGACCCGTCACCGTGC
CATGGCTCTGCTGGTGTACATGGGTGTACCGGTCACCCCGGCTCCCAATCCCTTCAACCTACCTTCCCCGGGCCATAGCTATCATATCATCCGGTTGATA
GACCCTTACCAGCCGCAGCTGCAAGTGGATTTGCTGATTAGAGATACTGACTTATACCTTGTCGCATTTCGCCGTTCACTCGATGACAATTGGGGCAATT
GGTATAGATTCAGTGATCAACAAGTACCTAGCTTTATTGTTGCTCTTGATTTGGGTTTCACTTCCAACTATTCTCGTGTTCCTGGCAGCATTCCGACAGT
AGGTGGTCCCGAGGACATGGTTTTTATCTTCAACACCTTGGCACGCCATGAGGACAGGTTGAGGTTGGGTGATTCCTGCAGTCCAGAGAACTCTGCACAT
TGCTACAGTCCTGAGAGCTGTGCAGAATGCTGCAGTGGTTTTCTGTGAGGTTATGAGATTCATTGCTGTTTTGCTCGAGATGGTCCGTAGACTGGAAGCA
GGGGAGGCCGCGTCTGTGTTGCCTGGGGAGATGTGGGATATGATTACCTCGTGGCATGTGGATTGTTGGTTTATCCTTGACGTGAGGAGGCGATTGGCGT
TACCCGCACATCACTGGGAAAGCCATGTTAATGAGGTTGACAGACAGAGATTCGATCAGCTGATCAACCGTGTGAGTGTCATCATCTACATTCCAGAGTT
GTTCACTTCTGATACACGGCGGATGACTCGACGGCAGGAGAATGAGGTGCGCAATATCCAGGATCCAGGTTTTCCCGCTGCAGATGCTTAGAGCCTGTTC
GGCAGCTCTCCGCTCCTGGAGCGGCCAGAGCATCATCGAACAAATCAGCTCCACGCTTTCCTCGTCCCGGAGTGGAGCGGTCCGCAGGCCATTTTCTCGG
AGCCCCCGTATTTCGCGGAGCTGGTGAATTGCCGAACAGGCTCTTAGTGTCATATCATGCTGTTCCAGGTCCTTGAGGGCTATGCTGATCTTAGTGTTAG
CACTGCTGCCTATAAGTAATTTTGTGTTGTATTTGCAACTGCTGTTACTATTAGCATAGACCATATAGGGTGTGGTGTCCCGTGACATCTTTGTGCTAGG
GTCATTATGTCTTGTGGTAGTTGATGTAGTCGCTGAGTTGCGTCTGGTCTTGATGATGAAACGTTTGGGATATTCCCCGCTTAATCCACTTGCAGTATCT
CTATACATCTGTAAATAAGCTGCAGATGTCCAAACAAACAC
page-top