Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig9255  (registered. 2007)
Contig Information
Length 1137 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_VHS Shoot with heat shock treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein AZC_4606 [Azorhizobium caulinodans ORS 571] >gi|158333119|dbj|BAF90604.1| conserved hypothetical protein [Azorhizobium caulinodans ORS 571]
Score 81
Evalue 7.09522
Total Hit Count 3
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig9255
CTTGTTGTTCTTATCTAAGATTTTGGAGTAGATCTTGTGCCCTAGGAGTTCTGGATTGAACTCTTGCTGTCCTATCAGCCTACGTTCGCCTCTAGAGCGA
TATCTAGCGCAACATTTTGAAACTGTTCCTTCAACACTTGTGATGTACACATTGTAGCAGCAAGGTGGAGTTGCTCCTTCACAACCTTTGTGCTGCTTCA
ATTACCATCACAATTTCCACTCTCGTGACCATCCATGTTGCCATGTGCACTCACCCCCGCAACCGCACCTCCTACCATCTTCGTTGCTAAAATTTGTGCC
TTTGTCAACTCAAGATACTGAAGCTGAGAGGTGTCAAAACCTACAGGTCTCGTGAGCATGATCTTGTACTCTTCCTCTATTTTCTTCGCCGGCATGACGA
GGTGGCGGGGAATGGCGCTTCCCTACTTCCCCGCAGGTTGGCTACGGACGAGCTGCTTGCCCGTTGGGCTGCCCGGGCCGGGTTGGCGGCGATGGCCGAT
GGTGGAGTCAGCCAAGGCGGGCGACGAGGCCACGACGGACACGGGCAACTGATCGGGATCGGCGGCGTGACGGACGTCAGGGTCGGCGGGGGCTACAGGC
GAAGGTACGTGAAACTTCACCCGGGAGAAAAAGTTTTCTTTTTTGCGCTATGTTTAGGAAAGGTTTACGGGAAGGGCTATATTCCCCTAGAATTGAGGGG
AAGTTGAGCTGATTATACGGTGTTTCCTAAAGAAAAATCGTGCTTACGGACCTGTTGGGAGCAGTTTTTTCTCGTCCAACTCACTCTAAACCAGCTTTTT
GTTACGGGAAAGGGACTTGTTGGAGATGCTCTTTAGCCCAGAGAATAGTGCTATAATCATCTAGTCCAACCAGTGTTAAGTATCAGGATGCGTTTAGCGT
TATGGTGGATTATGACAATCCCGTTTGCCAGTCCTTTTTTGTCTAATTTTTTAGTGCTTGTTTGACCTGTTTATGCATACTTTGGTGGGTAATTTGTTCA
CAAATACATTATAAAATAAGCAAAACGCAACACAGTTCGGCAACCGCAAACTGATCTTAGCAGTACATAACTTACTTGGAAGCTTACAAATTGCTTCCAC
CAAAGTAAGCAGCTTATGTATTTTATTTTCTCTCAAT
page-top