Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig9151  (registered. 2007)
Contig Information
Length 681 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_VABA Shoot with ABA treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit wound/stress protein [Zea mays]
Score 501
Evalue 5.80582e-49
Total Hit Count 42
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig9151
GCACGAGGGGCACGGGCGTCCGGATCGCCGACCTGGAGCAGTGGGGCGGGATGATGGGCGCCGGCCACGACTACTACGAGCGCGGCAACCTCGACATCTT
CAGCGGCCGCGGGCCCTGCATGGAGCGCGCGCCGTGCTGGGCGAACGTCACCTCCGATGGCGCCGGCGCGCACCACGGCTGGTACTGCAACTACGTCGAG
GTCACGGCCACGGGGCCCCACATGGGCTGCGCGCAGCAGCTCTTCACCGTCGAGCAGTGGCTCGCTACCGACGCCTCGCCCTACCGCCTCTACGCCGCCG
TCGACAACTGCGGCGACAAGCAGGCAGCTGCCAAGGGCCACGAGGCCAGGGCCGCCGCTCTGTGAGAAGTCTATGCACGCGCCGCGGCATAGCGTGAACT
GCACCCGTGCGATAGACTTATATTGTTGTAAAGCATGATACGAATTGATCGATGTGCGCGATTCGCTTTGGCCGGCCTCTTGTTAGCATTGACACGCCGG
AAATAAAGCCAGCGTTCGTTGTGTTCTGGAACGATCTGGTTGGTCAAATGAGGATGAGTTGTCTGTTAGCCTGTCAGTGTCAGTTCATCAGCTCTCGGTG
TATACGTCTATTTATCATCCCGGTCTATGTTCGGTCCTCTGTTTCTGGCTATACTATTATACTATTAGTCCAAAAAAAAAA
page-top