Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig9094  (registered. 2007)
Contig Information
Length 574 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_VABA Shoot with ABA treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os12g0615400 [Oryza sativa (japonica cultivar-group)] >gi|108862964|gb|ABA99849.2| 37 kDa inner envelope membrane protein, chloroplast precursor, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113649781|dbj|BAF30293.1| Os12g0615400 [Oryza sativa (japonica cultivar-group)] >gi|125537405|gb|EAY83893.1| hypothetical protein OsI_39115 [Oryza sativa Indica Group] >gi|125580075|gb|EAZ21221.1| hypothetical protein OsJ_035430 [Oryza sativa (japonica cultivar-group)] >gi|215706383|dbj|BAG93239.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737449|dbj|BAG96579.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215740713|dbj|BAG97369.1| unnamed protein product [Oryza sativa Japonica Group]
Score 534
Evalue 5.75974e-53
Total Hit Count 72
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig9094
AAGAGGAGTACATCGAATGGTTCACAAAGGCAGGGTTCAAGGATGTTCAGCTGAAGAGGATTGGACCAAAATGGTACCGTGGTGTCCGTAGGCATGGCCT
GATCATGGGGTGCTCTGTGACGGGCGTCAAGAGAGAAAGCGGGGACTCCCCTTTACAGCTTGGTCCGAAGGCTGAAGACGTCAGCAAGCCCGTGAATCCT
ATCACCTTTTTCTTCCGCTTCCTCATGGGAACAATATGTGCCGCGTACTATGTTCTGGTGCCTATTTACATGTGGATAAAGGACCAGATTGTGCCCAAAG
GCATGCCGATCTAAGGGAGGGGAATTGAGCTGCAGCGAAGAGAGGATAGCCAATATCTGAATTAGGCTTCTCTATATTAGGCACTTCACATCTGTTTTTG
TTTACCTTTTATATTTCCTGTTGTCGTGTATTTACTTTACTTTGGGTCTTGTTATGTGGAGAAATAATATTTATGACTTGGATTAAACGCGTCAGAGCTC
TTGAGCGTGAAATGGCTCATTTGTAGCAGGTCATTGTTTCACAAATAGAATGTATCTGNAATATTTCTCCCCCT
page-top