Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10417  (registered. 2012)
Contig Information
Length 659 bp
Clones alternative view 8 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 1
Wh_SH - 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_SHC Shoot grown with cold treatment 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XD Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115487054|ref|NP_001066014.1|| Os12g0119700 [Oryza sativa (japonica cultivar-group)]
Score 147
Evalue 7.00E-34
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig10417
TTAAGTTCAAGGCAAGCACAGAGAGACAACAAACTATTTTTCAAGATTTACAAAACGCTAGGCCGAAAGCCCACAAGGCACATGTGCTGGTACTACTACA
TCAATGATCAATCAGGGCAGTAAGACTGGGCTTAGCTAAAATTAAATGAAAACTAAACATAGATTTTACATGTATAACTTAAGGCTGCTTCCTACTCAAG
CATCACTGCTAGCTCTGTACAGCTTCAGAGTTAGCAAAGTTACCACTGACAGACATGCCTCTGTAGGATGCCAAGAGAAACGCACCAAGACCATGTTCCC
AAAGGAACAGGCTCAGCTCTTATTGTCTTCAGCGAAAAGAGTCTTGGGACTCACAGAACCGAAGTCGAGCTTCCGGCAGATGCCTGGGCTGAGCTTGATC
ATCTTCAGAGATGGTCGCAGAGGAGCATCCGGGCAGGTGTCCGCGATGCCGGTAAGCAGAGGCTTCGATTCAGGAGTCTTGTAGCTTTCAGATGGGATAG
CAGCATCTATCAGAACAGCCTCCCCATCTCCAGTTGCCTCCAGCGCTTGGTTTGAGATGATCAGATCAAGAAACATCTTGCAGATGCCCTGGAGATACAG
ATCTTCCTCCTCCGAATCATCAAACTCAAAGCTTAACCTCTTGACTGGGAAGTCATCAG
page-top