Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig8967  (registered. 2007)
Contig Information
Length 592 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cold-shock DNA-binding domain-containing protein [Serratia proteamaculans 568] >gi|157323056|gb|ABV42153.1| cold-shock DNA-binding domain protein [Serratia proteamaculans 568]
Score 290
Evalue 1.23403e-24
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig8967
AACAGGTTGAGATCTAGAAAGGGAGAGGAGACTACAGATACATACTGAGAGAAAATGCCAGCGCTTACTGGTCAGGTGAAGTGGTTCAACGAGAGCAAGG
GGTTCGGCTTTATCACCCCCGACGACGGCAGCAAGGACGTCTTCGTGCACTTCTCGGCAATCGTTGACGCCGGCTTCAAGACCCTCGCCGAGGGCCAGCG
TGTCGAATTCAGAATCGAAAGCGGCGCAAAAGGCCCGTCCGCCGCCAATGTCAAGGCCATATAGGAGGAGGAGCAATATCGGCATCCTTTTGTAATTTGC
TCCACCCGACCGAGCAAATGGAGTCCAAGAGTATGCTGCTTTAGGAAGGATTGTTATTTGTTTGTGTTCTATTCTCACCAGTGCACTAAAATCTGTACTG
TTTCTTTCTTTTCTTTTCTTTTCTTTTCACATCAAATCTACACGGGTTAATTACTGTTGCGTTCGGGTTTGCAAGGAATGTGGATTTTGTTTAAGTCAAA
TCTTTAAACTTCGAATAAGTTTGTACAAAGATGTACTGTATCAATATTCACAGTACCAAATCAATATCAATAAATTATCATGAAAAAAAAAA
page-top