Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10373  (registered. 2012)
Contig Information
Length 830 bp
Clones alternative view 116 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 2
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 2
Wh_r Root 3
Wh_yd Spikelet at late flowering 1
Wh_MS Seed DPA5 of DT3DL CS wheat 5
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 3
Wh_RDr Root of dessiccated seed 3
Wh_SHC Shoot grown with cold treatment 5
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 6
WH_XR Roots, 18 day old plants were grown hydroponically 4
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XT Roots, 18 day old plants were grown hydroponically 3
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 8
WH_XA Root 4
WH_XB Root 13
WH_XC Root, treated at 50 microM Al for 6h 12
WH_XD Root, treated at 50 microM Al for 6h 20
WH_XE Seedling, infected with leaf rust 4
WH_XF Seedling, infected with leaf rust 4
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242081753|ref|XP_002445645.1|| hypothetical protein SORBIDRAFT_07g023320 [Sorghum bicolor]
Score 313
Evalue 1.00E-83
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig10373
TTTTTTTTTTGTTGGAATCAAGCCATAGCAGAAATCCTCTTGTACAAAGGAGCAAAGTTAAACACAAGACAAAATTTCAATGAAATAAGCTGGCGACCCA
TAAAATGATGAGGTCCAACAGAAAGCACAAAGATCTGAGTTATGTCGGAATTTCAACAAGCCCAGTCCACATGTTATGGAATTCACCCAAGTTTGGATGA
TGAGATTCCAGAGGGACAAAGAAGTATTATTGAATGTTCTAGTAAAAGAACTTGGACTTTCGCCGTTATCTAGTATCCCCAGTAATCGTTACGGATCTCA
TCATCAAACTTCTTCTTGAGTTCAGGGTGCTTCGCAAAGTACTCGTCTGCTGTCATTGTGCTGATCTTTTTCTTCAACTCTTTCAATTCAGCAATCTCCT
TCTCTATCCTCTCTGATTCCTTCAGAGATGTCTTCTCTGCTTCCTTCATTTCGATTAACAGAGCATCAAACTTTGGCTTATACTCAGGAGTGACAGTGTC
AACATACTTTGGGATCTCAATGCTATCATAAGCCTCCTTGTACATATCCACAACTTTCGATCCAATTCCTTTTTTGTAGTATTCCCAGTCAATTGGCTTT
GGTTCCTGGGAGAACTTGGTCTGGAGCTGGTGGTTGACGTCCTCGAAGGTGCGGCGGAGGTTGGCAAACTCCTTTCGGGCCTCGTCGGAGACGAGCATCT
TCGCCAGGCCGTCCCAATCGATCGCCTTCCCGGCCTTGGCCGCGACGTCCGTCACCTTCTTCACCCCGCTCATCTTCGGCTCTGGATCTGCTAGACTTGC
TAGGGCTGTGTGACTCTTGATTGTTTCGGG
page-top