Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1037  (registered. 2012)
Contig Information
Length 289 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig1037
AAACCCTAACCCTAGATTGGATTACGGGGGCTGGGAGAGGGAGAGGGTCGGAGCGGCGGCGGCGGCGGCGGCGAGATGTCGGCGAAGAAGGGGCTCTCGA
GCACGCTGCGGAACCTCAAGTTTATGCAGCGGGCGGCGGTGGCGCAGAAGATTGAGGACAAGGCCGATGTCGAGGTGGAGGAGGCGGCGGCCGAGGTGGT
GATGACGCCGGCGGCCAACGGAGGAGGGGTTAGCTTGTCGGTCCAGGTCGCCAGGAAGTGTGTAGTTGTCATGGAGGGTAATCCACATC
page-top