Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10360  (registered. 2012)
Contig Information
Length 2013 bp
Clones alternative view 100 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 6
Wh_oh Pistil at heading date 2
Wh_r Root 7
Wh_CSEC Callus 3
Wh_KMP Shoot grown under continuous light 4
Wh_PCDAM Anther at meiosis 6
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 2
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VSCB Liquid cultured tissue 4
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 3
WH_XR Roots, 18 day old plants were grown hydroponically 3
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_SP 1
WH_XA Root 1
WH_XB Root 4
WH_XC Root, treated at 50 microM Al for 6h 6
WH_XD Root, treated at 50 microM Al for 6h 7
WH_XE Seedling, infected with leaf rust 3
WH_XF Seedling, infected with leaf rust 4
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 6
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 12
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 1
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|224998176|gb|ACN77848.1|| phenylanlanine ammonia-lyase [Phyllostachys edulis]
Score 1022
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig10360
TTTTTTTTTTCACCCAGAGCAATTGCATGTATTGTATTATATAGAAGCAAAACATTTTACTAGGATTTTAATAATACAAGCAAAAAAAGAACCACATAGT
ATTAGCATGATTCACCCCAAAATACAACGACAATAATATCTTTAGGTAAAGCTGCGGCAGAGCAGCTACACAATTAACAACAAGGCCACACGTCGATCAA
CACCAACGCACGAACAACGAAAGGCAAAAGGCGATAGGAACTGAAGAAGAAGAACATGCACGAACGAATTAAGCGTCTTATTTTTGGATGTACTCTGGAA
GCCTCCTCCTCTCCTCCACGGTCGCACGGACGATGCTTCAGACGTTGATGGGCAGGGGCTCGCCGTTCCACTCCTTGAGGCACTCCAGCATGGGGTCGAT
GAGCTTGTTCTGGCTGATGCCCAGGAAGACCTTGGTGCACTCCTCGCCGGGGGACAGCAGCTTCTCGCCGGTGAGGTACACGCAGCCGAGCTCCTCGCGG
ACGAAGCGGTACAGGGGGAACGACCTGCTCTCCTTGATCAGGTTGGGGATGGGCGCGGTGCCGTTCTCGAAGGCCACGCGGGCGGCCTCGATCTCCCGCG
GCAGGGCCGACCGCAGCTCCTCCTCGAACTTGTTGATCTTGGAGAACACCGTGGCCTCGCTCTCGGCCTCGCCGGGGCCGGCGGTCAGGGCGTGGTCGAC
CAGCACGGCGCGCAGCTTCTGCATCAGTGGGTAGTTGGCGCTGCAGGCGTCGTCGGCGTAGCTGAACACGGCCTCGCGGTCGATGGCGGTGATGAGGCTC
TTCTCGCTGAAGCGCGCGCTGGAGAGGTCGCCGGTGGGGTTCATGGTCAGCACCTTCTTCGACACCTGCGTCACGCAGTTCTTCACGGAGGTCTTGATGT
TCTCCTCCAGGTGGCGGAGGTCGATGGCCTGGCACAGCGCCACCATGTATGTGGAGGACATGAGCTTGAGGATGTCCACGGCCTCGGCGGTCTTCCTGGC
CGAGACAAGGCCCAGAGAGTTCACGTCCTGGTTGTGCTGCTCAGCACTCTGGACATGGTTGGTCACCGGGTTGGCAAGGTACTGGAGCTCAGAGCAGTAG
GAAGCCATGGCGATCTCCGTGCCCTTGAAGCCGTAGTCCAGGCTCGGGTTGCGGCTGCCTGCCAGGTTGGAGGTCAGCCCGTTGTTGTAGAACTCGTTGA
CGAGCTCCGAGAACTGCGCGAACATGAGCTTGCCAATGTTGGCGATGGCGAGACGGGTGTTGTCCATGGACACACCGATGGGCGTGCCCTGGAAGTTGCC
GCCATGGAGTGCCTTGCCACGGTGGACGTCGATGACGGGGTTGTCGTTGACGGAGTTGACCTCGCGCTCGATGGACTTGGTGGCAGACCGGATGACCTCG
ATCTGGGGGCCGAGCCACTGCGGCGACGTGCGGAGCGCGTACCTGTCTTGCTTGGGCTTGAGCTGCGTGTCAATCTCGTTGACCTTCTTGGCGTGGCCCA
TGAAGGCGCTGCCGGCCAGGATGTGCTCCATGATGGCCGCGGCCTCGATGGAGCCGGGGTGGTGCTTGAGCTTGTGAGTGAGGTGGTCGGTGAACTCGGG
CTTGCCGTTCATCACCTCGCAGAAGACGGCGGACAGGACCTCGGAGAGAACAGCGAGGACGTTGCAGTCGAACAGCACCGTGGCCGCGAGTGCAGAGCCC
ACGGACGTGCCGTTGACAATGGCGAGACCCTCCTTGGGGTTGAGCTTGAAGAAGCCGCCCTCGATGCCAGCGGCCTTGAATGCCTCGGCGGCGTCCACCT
TCTTTCCATCAACAGTGGTGGCCTGCGCGTTGGGGCGTCCGGTGATGAGCCCGGCGATGTAGGACAGTGGCACAAGGTCGCCGGAGGCGGTGATGGTGCC
CCGGAGCGGGAGGCAGGGGCTGACGCCGGTGTTGATGAGCTTGGTGATGGCCTCGAGGATCTCGAAGCGGATGCCGGAGTAGCCCTGGAGGAGGGTGTTG
ATGCGCACGAGCA
page-top