Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1036  (registered. 2012)
Contig Information
Length 837 bp
Clones alternative view 12 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 3
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_SHDr Shoot grown with dessication 4
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig1036
CGTGGCGCTACAGTGAAGCGGATGGTACAGAACCGTCCCACTACAGTGTTCAAGCATTGTTTTTTATTGGAACTGTAATTGGGCCGGCCCAGTTGGATGG
ACCCTGTGTGAAGCCAGAGCTTCTTGACGCACATGGGCGTCCGACAGGGACTCTCGGCTTATGGGCCATGGCAAAAAAACCACTACAACTTTAACGACGA
GTATCACAAATCACAAGGGAAATATGCAGGGTTCAGAGCAAGCAAGCCCTCCGCAGACGATCAAATGTCATCGTCACTACCTCTACCTGGACTTGCCCAA
CCGCATTTCCGATTTGGCAACAATAAAGCAAACCACGTAAAAGCACATCAAACACGCTAATCCGGCTATCGAAGCCGAGCCTCGACCCTAACTCCTCCTG
ACGCCATCATCGTCGCCAAAAGAAGCCAACACCTCAGCAAAGCACGCGGGCAAGAGGCCGCTGCTTCGAGACGATACAACGGATCTAAGTTCCCCTCCGA
AGCTGTGGCGGCCATGGGAGAGGGAAGGAGCACAACTTCCGAAGACATGGACGTGAGGAGAGGGAAGGAGCACAGCTTCCGGACGATGCTTCCAGGAAAG
AGTACGACGCCCGCGCGTGTCGCCGTCGCCTTCGCCGGATCCGGCTTAAGACCAGAAAGAGGATTTCTTCCGGAGACAAGCACGAATCGGCCAACCACAA
ACCGCCGCCTAACAACCACGACAGAGCCACAGCCAGGACAACATCATGGCGTCCGTCGCTAGCTGGAGCAGAGGTAGAGGAGGGGCGCGAGGTAGAGGTG
AAGGGTGAGGAAGAAGACGCCGGCGACGGCGACGAAC
page-top