Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10350  (registered. 2012)
Contig Information
Length 884 bp
Clones alternative view 73 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 9
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 1
Wh_DPA20 Seed DPA20 1
Wh_EM Dormant seed with water absorption 1
Wh_OKCS Seed DPA5 1
Wh_RDr Root of dessiccated seed 3
Wh_SHC Shoot grown with cold treatment 3
Wh_SHDr Shoot grown with dessication 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 3
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 3
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 2
WH_XR Roots, 18 day old plants were grown hydroponically 3
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XB Root 5
WH_XC Root, treated at 50 microM Al for 6h 3
WH_XD Root, treated at 50 microM Al for 6h 8
WH_XE Seedling, infected with leaf rust 3
WH_XF Seedling, infected with leaf rust 4
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 10
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|50400847|sp|P83970.1|PMA1_WHEAT|PMA1_WHEAT RecName: Full=Plasma membrane ATPase; AltName: Full=Proton pump
Score 320
Evalue 1.00E-85
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig10350
TTTTTTTTTTCCATTGCAGAAAAGCCAGCTATTTTTTTTATAGACGAGAATTGTCTTTGTATAAACCCAAGTGAAGGGATAGCAAGCATGGGGCAGAAAA
TTTGCAGTGATTATTTCTCGTCTTGCTTCCGCAAGATCACCGACTAGTTAGGGGAAACTGGGTAAAACGCGAAAACGATTACAACCACGCCGTGCTCCAA
ACACGGTATAACTCCACTAGAACATTAAAACCTCTCTAGAAGACGGACAACCGAAACCATATATTTGGTAGCACTTTACAACTAGGGGCTGGTCAGATCA
GCCATGTTTGTTTCATTCATTCACCGGAAAAATCTTAAAGCGGAGCTCCATTCCAATCTCGCTCCAATACGGATGTCATGTTTGTTGGTTCAATGTCGAA
TTTCCTCACACGGTGTAGTTCTGGTTGATGGTGTCGATGTCAAGGCCCTTGAGCTTCACCACGGATTCAACGTGGCCCTTGAGTGTGTTGAGCTCCCTCA
ACCTTGCAATCTCAGCTCTTCTCTTTGCTTGCTCAGCGATCTCAGAGAGCTCACGGTAGCTGCTCTTGTCGTTGAACAGTGTGTGGGAGGCCGGCTCGGG
TGCTTGAAGGCCATGGAGTGTTCTCTGTGCAGTAGCCCATTGTGCTTCCCTCTCCCCTTTGCCGTAGTTCTCTTTGGTGGTGAAAGCAGTCTTGTTCTGC
AGGAGGTTGTCCCAGGCCCTTCCACTCAGCACAAATCGGATGAAGAACTTGAAAATGTCAAGTGGGAAGTAGAACACAATGCTGAAGAGCCAGATAACAC
CAGCCCAGCCCCACCCGATTCCCTTGATCCTTGCAAACTCCCAGTTGGCATAGACAGCGATGAGTGTTGCAACCAATTGTGCAA
page-top