Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10344  (registered. 2012)
Contig Information
Length 1554 bp
Clones alternative view 14 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 2
Wh_PCDAM Anther at meiosis 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XE Seedling, infected with leaf rust 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115442099|ref|NP_001045329.1|| Os01g0936800 [Oryza sativa (japonica cultivar-group)]
Score 493
Evalue 3.00E-137
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig10344
GTAAATAATGCAGAAAATTATGCTGTTTTGTTCTCGCTAGAAGCCTAGAACTGAACCCAAACACGCAAAAAGAATCACCAAGAGGAACAAACTCAAGGCT
AATTAGCCCACAGGAGTACCCAAGCACTTTTTCAGGCGGTTCTATATAATGTAAACGCTGTTCTATACAGGCAGGCTACCGGCAATAACCCTGGTATGTT
CAAAACCGTCTCAACTAATTAATAACAAACGATGGTGCTGCTAACAGGGATGCTCCTGCAACATTTATGTATATAGCTGCCCTTCAACTCTTGACGAAGA
CTGAAGCACCCGGCGGCTTGGATCTCCAACATACTCCAACTCATAGGCGCAAGAGGTAGCCGAGGGAGGTGCCGAGAAGCGCCACATAGACCACAAACAG
CAACGGGAAGCCTAGCTGACTCTTTGGGGTTCCCTTCTTTAAAAATACCATCTCTTGCTGCAGCCTATCCCGCTCCTGGGTTGTAGTCCGGCTCTCTTCT
CTCAGTTTTATTATCATCTTTTCAGCCCCTTCCAATTTTGATTCAAGGTTGTTGAGTTTTGACTTCAGATTCTGAACATCTTCCGTCACATGAGATAATT
GATGATTCTGCACACTGAAAAAACCTCGGTCACTTACGGTGACAGTTTCTTTCGGAAGAGTTTCTTCCAGAGGAGACACCTTTGAAGTTACAGTCTCTTC
CTTCAGAGGAGAAAGCTGTTCAATGGTAACCGCAGACGTATCCTTTATATAGGAAGGAGATTCATGTTTTAGAGGGGGAGGAGATTCGTCTTTTAGAGGG
GGAGGAGATTCTGCCAAAATAGCAGGTTCTTCATGCGGTAGCACAGGAACTTCTTGAAGGATTGGAGACTCCCTGACAGGGGAAGGTATGTTAGGAACAA
CAGCTGAAATTTTCTCCTGGGGGGCAGGAATCTTTTTCTCCATAGCTGGCACTTCATTCTGAACATTTGGTGTATCTTTTAACACCGGAACCTCAACTGC
CGCATCAGTGCTGGGGACATTATTTATCAGTTGCTCCACAGGAGGACGAGATGCATCAACAAGGACAACTCTCAATTTACTTTCCTCAATATATGCGTTG
GTTTCTTTGGAGAAAAAAGCAGGAATGAGGTCATCATCTGATGTACCAGGAGGAACAACTGTGGTCTGCACCAAAAATTTGTCTTTTAATTGCATGTCTG
GTGGCGCAGTACGCTGTGCTTGCATGGTAACTGTGAAATCACATGTTGCCCTTGGAAGGATAACTCCAATATTTGGTCGGACGCAATATCTTTTAGGGGA
AGTTGTCTTAACCTTGAAAGCGACATATTCATCGGATTTGTTGACAAGATGGACAGAACATGAACTCTGCTTCTTCAGCTCAAAGGTGAACTGGAGCTCG
CGGGGCTGGATCTCGACGACGCCCTGGCCCATCGCCGCCACGGAGAGGGTCAGACGGCAGCGCCTCGCAAGCGAATCGGTGAACCGCCGCCGCCGCCGGT
GGTTGCTGCGGAAGCCCCCGATTAATCCCTCCACCGGTAGGCAGGAGCGGTGGT
page-top