Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10342  (registered. 2012)
Contig Information
Length 356 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 2
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig10342
ATTCACAGTAGGTCTTAACCACCAGAAATTATTGACAGGCGCTGATGATCAAATCAAAATAATGAGGTCGTCAAGGCTAACATTTGCCTAGGAAACAGAT
TATGTGGACAAAGGAGGAATTCAAGATCAAAATGAAAGCGCAAAGAGATGACCTGGGGCCATGTTATTCCAATCCAGCAGAACTTAACTTTTTTTTTTCA
AAACATAGGGTCCCAGCTGTGCATCTCAAGGCTTTAGCACCAATGACAGACCAACTTTTGTGCTCTTCTCAATTGCCTTTGTGTCAACCTCGCCNNNNNT
GGTGACAAGTGACTTGGGTCGCCATTCATGCTGGACAAGGGCACTGGCCATGCCAT
page-top