Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig8261  (registered. 2007)
Contig Information
Length 612 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_VABA Shoot with ABA treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_37978 [Oryza sativa Indica Group]
Score 328
Evalue 5.23808e-29
Total Hit Count 170
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig8261
TGCAAGTATCACCATCCAAGGTCACTTGTGCCTCCACCAACAGCCGGAGCTCTTAGTCCTCTTGGCTTGCCACTCAGATCTGATCAGCCCGTGTGCACAT
ACTATGAACGTTATGGAGTCTGCAAGTTTGGACCAGCTTGCATGTACAATCACCCTTTTAATTTTGGTCATCCTGTATCCGCAGCAGGGCCACCTCTCTC
TGCTCAATACCTCACTTCAGGAAACTACACGGTCTAGCAAGCAGGGCCGATTTTTCTCTGTGGTCGCCATGATGCTTGGAATAACACTTCCACTTGTAAA
ATAGCGCAGCTGAAAGTTGCAGGGTTTTCATGTTGACGATAGAGATCTGGTTTGCAAGTCAGCAACGAAGTTGCATGAAGTTGGGTGCATAGCCGCTGGG
ATTCGTAGAAACTAAACACGTTTCGATACATGACACTGCTGCCCCTTTATATTGTAGAGCACTTGACGGTTCGTACACAATTGTTGCGTCAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAANAAAAAAAAAA
NCAAAAAAAAAA
page-top