Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig8152  (registered. 2007)
Contig Information
Length 245 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit flagellar associated membrane protein [Chlamydomonas reinhardtii] >gi|158278897|gb|EDP04659.1| flagellar associated membrane protein [Chlamydomonas reinhardtii]
Score 83
Evalue 0.705826
Total Hit Count 18
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig8152
GGCGACTCCTCTCTCGCCAACCGCCGTGGTGATGGCACTGCTGCTGGCCTCGCTGGTCGCGCTCTCCTCGGAGCACGACGACCACCACCACGCGCCGGCT
CAAGCGCCCAGCCCCGCTCACCATCTTGCCCCCGCGCCGAGCGCTCATCATCATCACGCTCCTGCCCCGTCGCCGAGCCACCACCACTATCACCACGCTC
CGGCCCCGTCNCCGAGCCACCACNATCATCACCAAGCTCCGGCGC
page-top