Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10329  (registered. 2012)
Contig Information
Length 877 bp
Clones alternative view 10 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_yd Spikelet at late flowering 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XF Seedling, infected with leaf rust 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218190429|gb|EEC72856.1|| hypothetical protein OsI_06609 [Oryza sativa Indica Group]
Score 427
Evalue 8.00E-118
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig10329
ATCTTATCATACCATCATATCAATCGCACAAAGCGTATTGCCATATCCCACACCAATTATGTTGCTACTATACCAGTAAGTACTTGATGTCCAGCATGGA
TACTAGTGGAGAGGAACCATTTCCTGATAGCACACGACGGTTGAACAAGTCACGGAGCCCTCATCTAAGCAGTAAGAATTTCACTGTGTGGCACGATGGC
AACCTTCGCTGGTTCTGCTGATTTTTCCTCTTGTTGTGCCCCTCTAGTGGAGCCACCGTATGCTTCTAGCTCTCTCTTTGCAAAGGTTGGAAGAACAAAC
GCTGCTCTGTGCATCTCTGTATTATAGAATCTGATGTCCCTCCCTGCTGTCATAGCGCCTTCTATTTTTTCAATTGGATTTATGGGTGCCAGGAAGTTGA
CTGGTCGACCCTCTTTGGAACATAGCAAAAACCCAATTGCACCACTAGGATATGTTGGGACACTTGCCCAGGCATAGTGGACAGAACCCTTGAAAGTCTC
ACAGCAGATCGAAAGCATGTCCTGAATCAGATGTGTATGCAACCACATACTCTCAGCTTGATTACAAAGAACACCACCAGGTCTCAAAGCTCTAGCAATT
GTCTCAAAAAATGGCTTCTCTACAAGTTCCTGAGCAGGCCCTATAGGATCTGATGAATCAACAATAATAGCATCATATGTCCCTTCAGGAGAATTTCTTA
GGAACTCCACAGCATCACCAACATGAAGTCGAACACGAGGATCCTTAAATCCGACAGATAAGTCTGGGAAGAAATCTTTACAAACATCAATAACTAGCTG
ATCAATTTCACATATATCAATAGACTCCACTGAACCATGTCTGGCTATCTCTCGAAGTACACCACCATCTCCACCTC
page-top