Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig7808  (registered. 2007)
Contig Information
Length 767 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_SHC Shoot grown with cold treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative thionin Osthi1 [Oryza sativa Japonica Group]
Score 151
Evalue 2.83298e-08
Total Hit Count 86
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig7808
TCCACCCTTTCAATCACTACCCAACCGAGTACTGAACATGGCGATGAGAGGCGGTAACAGCAACGCCATGTCCTTGGCGTTCATACTCCTAGTTGTGGGT
CTTGTAGCCCTAGAGCAAACCCAGCAAGCACAGGCATCCCACTGTTGTTGCCATCTAGACTCGGTCCCTACCTATTTTCAGTGCCGCGAAAAATCTGACA
GCACCGTCTCTGAGTGTTGCGGTGCTTCTGCTGGCTATATATCAAACGACGCTGGATTTGAGTGCAAGTCTGGTTATATTGATATAGAGACTGCACTGCA
AGCCACCAACTACTGCAAGATTGGGTGCACGGCTTCCTTGTGCAACAAATTAACTCCATCTGGGAAAGGTGCCATGGAACACTGCACCAGTGGATGCCAC
GATCTGTGCACCAAGAACAACGCGGAAATTGCACAAGTCATCACGGCTTAACTAGTTATGCCAAGGAGCTGCATCTAACAAGCCCGCCAAGGAGTGTTTA
TGTTGCCTTCAATAATTTGTGCCAAGTCCAATAAGGATCATGAGCTGTATGATGCATCTTCCTGCAAGGATGTATAGTGCTCGATCATCGTTTCTTGTTA
AAAAATTTATGTTGTATCCTTGGTATATGGCATGATGACGCCACGCTTTTAGTGAATCTTGTTTAGTTTGCAAATTACTATTGTACTTCGTTCTCGCGAG
TCATCTTGCTTTCTTCTTGCTTTTGATAGGGGTAAGCAATGCCGTTGTTGGCAAGGTGTCTTTGAGG
page-top