Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10282  (registered. 2012)
Contig Information
Length 815 bp
Clones alternative view 23 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_r Root 3
Wh_EM Dormant seed with water absorption 2
Wh_SHC Shoot grown with cold treatment 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 4
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XD Root, treated at 50 microM Al for 6h 3
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|84795234|gb|ABC65853.1|| drought-responsive factor-like transcription factor DRFL1a
Score 229
Evalue 2.00E-58
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig10282
TTTTTTTTTTACAGCACAAAAACATGCCTTCATGAATTTACAAGACAAAACGAACATTAACAACAAAATAATATTCCACATTACACGATTTTTTACGAGC
TAATTTTACATGACAGACTCCCACTGTTACAATCTGCAGAGCAGCGGAAGGAACAGCACCTAGCTAGAACCATGGACACAGAGACTTCACCGGCCGGAGT
CACTGACCAGTGACCGACCACCGGAGACGCCGGGCACAAAAACGCCGGCTTATAGTCATCCGGGACGGACTAACCAAACCCTACCCACAAAGAGAACAAA
TAATAGATCTACACAATGAACAAGGATTAGAGACTTAGAGCTAATCCGCTAAAAGCCCGTGCAGAATGTCTAAAATGCCATCTGCATCGCGGCGACCCAT
TAACCTAGCATCATGAAACGCTAAAGACGGTAGTAGTAGTAGCTGACGAACACAAACTGGGTGCTAATTGGTGGCGAGAAGCGAGTCCCAGTCGATCTCG
TACGACGGGTACTTGGTGAGGGCGAAGCAGGCTGCCTCGTCCCATGGCGCCTCGCTGAAGTCGAGCTGCTGCATCTCTGGAACCTCTGCTGCGGTGGTGG
TGGCGGGTGACGGTGACGACTCCGCGGACTCCAGCGAGGACGACGCCTCGTCGGAGGACGGCGAGGAGCAGTTGCTGGTGGGGGTGGACGACGTGGCTGC
GGCGGTGGACGCGGAGACGGAGGCGGACTTCTTGCCGTTCTTGGAGGCGGTGATGTTCTGGCAGAGGGTCTGGAGCTTGGCATCAACGGAGGCATGGAGC
GGGCCGCGGGAGGCG
page-top