Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig7637  (registered. 2007)
Contig Information
Length 706 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_OKCS Seed DPA5 1
Wh_VHS Shoot with heat shock treatment 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os06g0677500 [Oryza sativa (japonica cultivar-group)] >gi|52076622|dbj|BAD45523.1| putative Rab geranylgeranyl transferase, a subunit [Oryza sativa Japonica Group] >gi|52076908|dbj|BAD45920.1| putative Rab geranylgeranyl transferase, a subunit [Oryza sativa Japonica Group] >gi|113596397|dbj|BAF20271.1| Os06g0677500 [Oryza sativa (japonica cultivar-group)] >gi|125598230|gb|EAZ38010.1| hypothetical protein OsJ_021493 [Oryza sativa (japonica cultivar-group)]
Score 734
Evalue 6.00758e-76
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig7637
GACATGGGAGACTTTCATGAAGTACTGTTCAGTCCAAGTTAAATCAGAGTCAGCTCCATTGAACCATGTGCAACTTTGTAGATTGTCTCTAACACGCATT
GGGTTTACTGAACGCGTGTTGTGGATTCAAATGCTGGACCTAAGCCATAACAGCCTCAGATCAGTTGAAGGTTTGGAGGCTCTGCAGCAGCTTGTGTGCC
TGAACATCAGCAACAACCAGATCAGCAGTTTCACGTCACTCGAACCCCTGACGAAGATAGTTTCTTTGAAAGCGTTGGATTTGTCTTTCAACAAGATTGG
AGCTCACTTGATCGACACGACACGTTACATGTGCTCATCTCCATTTTTGCACAAAGTCGAACGGTGTGAAGCCTTCGAGGAGTGCCGAAAGAAAAACGTC
AATGTGGAGGAGTTCTGGGACGCCATACTCTTCTTCAAATCCATGGACCTGGTGCAGCTTGACTTCAAGGGAAATGCGGTCGCGGACAAGGATAGCTTTG
CAGCTGTCGTGTCGACCCTCAGCCCTTCTCTGAAGTGGCTCAACGGCACATGTATCCATTAGCTGTTCATCGGAGAGTGGAACTTGTGATAGAATGGGGA
AACTGGACACTGTACACTGCTATTTTACCTAGCTGCTAATGTCTGATTCATGTATTATTAGTTATAAGCAGCTATGAGAGACTAATACAATTATACTACA
AGTATC
page-top