Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig7571  (registered. 2007)
Contig Information
Length 917 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_OKCS Seed DPA5 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_021071 [Oryza sativa (japonica cultivar-group)]
Score 524
Evalue 2.18475e-51
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig7571
AAAGACCTCACGGGCAAAGGCACCATAGAAAGCGGTTCGGGTACTGGACGTATACCAGTGGCAGACAATATTTCCAAGCATGCTGCTGTATCTGTTCACC
CGAAGTCGAGCCAGACAGCTCAGAAAATACTCCAGCATCTTGAGAGGACAATTCCATCCCCTACAGTAAAGCCAGAGCTAAGGCGAACTGCAAAGAGAAC
TATTTCCCCTGTTGTCATCAGCAGCCCGTATAAAATGCCCGACTCCATCACTAATAATGCTCCCAGACAGAACAGCCTCAATGAGCGTGCCAGTGCTTAT
CAGGAAATTTCAAATGTGAAGAAGGTTCAGGAACCCCCAAGCAGCTCCAATTGTGAGGAGCCGGCTCCAAAGGTCCAGAGCCCAGTGGCCACCCCAGAAG
TCGCCGCAATGACCAGCTCGCAGCATCCTTCAAAACCCGACGTGGCAACTGCACCAGCTGCAGCAGTCTCGGATAAAAGCGCGACCAATGGTTTCATGTT
CTCGTTCCCTGTCACCAAAACCTCAGTTTCGCTTCCAGAACCGCCACCCACACCTACTTTCTTCTCACCGCCAAAAAGGAGCCCCCCAGCTGACATCCAA
GATATCCCCAAGTTCAACTTTGGCTCAGCAAGCCCTACGGATAATCTTGTTTTCTCCGTCGATTCGGCGAGCGTCTCTGCTGGTGCAGAGGAAGTGGCTC
CAACCTTCAAGATTGGGTCGGACAAGAAGCGAGAACTGTCCTTTGATGTGGCTGGGAAAGATGCAGTTGTCTCTTAGAGATGGGCATCCTCTGCCATCTG
AACCCGGTCGCCACTTGTTATTTGCTGGGATGACGGCACCATTTATAACAAACAATACATGACTTATACAAGAAAACATGGGCCTCGCATACCCCAGTAT
TTTCTACGTATATTTTT
page-top