Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1027  (registered. 2012)
Contig Information
Length 830 bp
Clones alternative view 11 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 1
Wh_OKCS Seed DPA5 1
Wh_SHDr Shoot grown with dessication 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XD Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|2493132|sp|Q40079.1|VATB2_HORVU|VATB2_HORVU RecName: Full=V-type proton ATPase subunit B 2; Short=V-ATPase
Score 353
Evalue 1.00E-95
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig1027
TGCCCAGCTCAACTTGTTCTCGATTATTGTTATTTTGCGAGGAACTTATCCTCCATTATTCCCCTTCCTTGCAACAATTGTCCTCAGCAAGATGATACAT
GACGCAATTTGAGCATCAATGTTGCCCAAATTGCTAGATAAATCATGTTTTTTGTCAAAAGAATTGATGTTTTGCTAATGCTAGCACAAGTTTGAACTAC
AAATTGGGAGGATAGCACAATATATATTAACTGAGCCCCTGGCACCGGTTTATTGCACAACAACAACCAATTTCCATGATGGCGCCCAAATTCTGACTTA
GTGGGAGGCATCACGACTGTAGAACTGATCAAGGGTCTTCGCCGGTATACGGTGGAGCAGCTCACGGGGGAAGATGCGGAGTAAGGTCCAGGCAAGGTCA
AGCGACTGGAAGATGTTTCGTGTGTCATATGCTCCCTGAGCCACAAACTTCCGCTCAAACTTGTCGAGGAACTCAAGGTAGAGCAAGTCCTCTGATGACA
GTGCTTCCTCTCCAACCACTGCCTTCATCGCCTGCACGTCTTTGCCTATGGCGTAATTGGCATATAGCTGGTTTGAGACATCAGAATGATCCCGGCGAGT
CATGCCTTCGCCAATAGCGCTCTTCATGAGCCGCGAAAGCGAGGGAAGGACATTGATTGGTGGATATATCTGCCGATTATGTAGCTGCCTGTCAATGTAG
ATCTGCCCCTCGGTGATGTAACCAGTAAGATCAGGAGTTGGATGGGTAATATCATCATTAGGCATGGTTAAAATAGGTATCTGCGTAATTGATCCTTTTC
TTCCTTCTATACGACCAGCACGCTCATAGA
page-top