Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1025  (registered. 2012)
Contig Information
Length 1174 bp
Clones alternative view 20 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_e Seed DPA10 1
Wh_CSEC Callus 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_PCDAM Anther at meiosis 1
Wh_RDr Root of dessiccated seed 1
Wh_SHDr Shoot grown with dessication 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XA Root 1
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XF Seedling, infected with leaf rust 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 4
WH_XV Leaves, plant was grown at constant 23℃ 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242066502|ref|XP_002454540.1|| hypothetical protein SORBIDRAFT_04g032970 [Sorghum bicolor]
Score 664
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig1025
AGCCGTCTACGATTTCCTCTCTTCGCCTTCCTCCCCCGCCGGCCCCTCCAAACCCTAGGCGCCGCCGGCCAGGAAGCCCATTTACCAGCCATGTTTGGAC
GCATGCCAAGGAAGACCAGCAACAACACCAAGTACTACGAGGTGCTTGGTGTATCCAAGACAGCAACCCCGGATGAGTTGAAGAAAGCTTACCGGAAAGC
TGCTATAAAAAACCATCCTGATAAGGGCGGAGACCCTGAGAAGTTTAAAGAATTGGCACAAGCTTATGATGTTCTCAATGACCCTGAAAAGAGGGAGATT
TATGACCAATATGGAGAAGATGCAATCAAAGAAGGGATGGGAGGCAGCGGCGGCGCTGATATGCATAGCCCCTTTGACATATTCGAACAGCTATTTGGGG
GTGGCGGCGGCGGCTTTGGAGGGGGTAGCTCGAGAGGACGCAGACAAAAGCGTGGTGAAGATGTGGTGCATACCATGAAGGTTTCGTTAGAAGACTTGTA
CAATGGTGCTACCAAGAAGCTATCTTTATCACGGAATGTTCTTTGTGGAAAATGCAAGGGAAAGGGATCCAAGAGCGGGGCAACGGCTACTTGCAGTGGT
TGTCGTGGTGCAGGAATGAGGATGATAACAAGACAGATCGGACCTGGCATGATCCAACAGATGAATACTGTTTGCCCTGAATGCAGAGGATCAGGCGAGA
TGATAAATGACAAGGATAGATGCCCAAGCTGCAGAGGGAACAAAGTATCCCAGGAGAAGAAGGTCTTGGAGGTTCATGTGGAGAAGGGAATGCAACATGG
CCAAAAGATTGTATTCCAGGGTGAAGCTGATGAAGCTCCTGATACAGTGACAGGAGACATTGTTTTTGTCTTGCAACTTAAAGAGCACCCAAAATTCAAG
AGGAAGTCGGATGACCTATTTGTTGAGCACACGATCTCTCTGACTGAGGCTCTCTGTGGCTTTCAGTTTGTTCTGACCCATCTTGATGGTCGGCAGCTTC
TGATCAAATCCAATCCTGGGGAGATCATCAAGCCTGGCCAGCACAAGGCCATAAATGATGAGGGCATGCCTCAGCATGGCCGGCCTTTCATGAAGGGTCG
CCTGTTTGTTGAGTTCAGCGTGGAGTTCCCTGAGCCCGGAGTACTGACCCCTAGCCAATGCAAGTCACTTGAGA
page-top