Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig7331  (registered. 2007)
Contig Information
Length 541 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit low-molecular-weight cysteine-rich protein LCR70 precursor [Zea mays] >gi|195659187|gb|ACG49061.1| low-molecular-weight cysteine-rich protein LCR70 precursor [Zea mays]
Score 121
Evalue 3.85068e-05
Total Hit Count 100
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig7331
GAGCACTTGGCCATGGCGTTCAACGGCGCCCAGATGCTCGCTGCCTTCACCCTGGGCATTCTCCTCATGGCCTTCTGTGCGGAGGCTCGGGTATGCATGT
CCCCTAGCAAGTGGTACAAAGGGGACCCTTGCAAGAACCTGCGTTGCACCAAGGCTTGTCACAAAGAACACTTCAAGGGTGGGTTTTGCTCCAGTAAAAA
GTCGATCGTTGATGACGAGCTCAATGAAGACAATGGCAACAACAGCTTTGGCAAACGGCCTAAGAAAAAATCGAAAAAATCGTGCATGTGTACATTCCCA
TGCGGTCAAACCCCACCACCACCGTCGGAACCTGATGTGCCAGAGCCGCCCGAAGTGCCAGTGCCCGGGCCACCGCCGAGGGCCGGCCATATTTATTGAG
TGAGTAAATGATCGTATGTATGAACCTGAGGTCTCGAGGAAAGAGAGGAAACAATCACTGCTTAATTTGTACACATGCATGATTGATTGCATAAGAATGA
CAATAATAATAATCTAAAGTGAATCAACAGTAAAAAAAAAA
page-top