Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig7330  (registered. 2007)
Contig Information
Length 784 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit OJ990528_30.1 [Oryza sativa (japonica cultivar-group)] >gi|38347453|emb|CAE02496.2| OSJNBa0076N16.22 [Oryza sativa (japonica cultivar-group)] >gi|116310337|emb|CAH67352.1| OSIGBa0130B08.12 [Oryza sativa (indica cultivar-group)] >gi|116310738|emb|CAH67533.1| H0425E08.1 [Oryza sativa (indica cultivar-group)] >gi|218195110|gb|EEC77537.1| hypothetical protein OsI_16435 [Oryza sativa Indica Group]
Score 1037
Evalue 2.34137e-123
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig7330
ACGACTCAGCGGACGACGACTTCTACAGCGGCGGGGAAGGCTGGGCTCGCCGCCAGCGATGACGGCGACGGCGACTACGACTTCGCCGACCACGACTCCG
ACGACTCCCCCGAGCTCCTCTCTCACCGGCAGCAGCAAAATTACTGCATATTGAGTGAAGCTGGTATAAAGCAGCGGCAAGAGGATGACATAAATAGGGT
TTCAACTGTTCTCTCAATTTCAAAGTCGGAAGCATGTGTTCTTCTTCGCAGCTATAACTGGAGTGTTAGTAAGGTGCATGATGAATGGTTCGTTGATGAA
GAACGTGTTCGCAAGGTGGTTGGCTTTCCGGAGAAGCGCATTGAAATGCCAAATGACAGAGAACTGGCATGTGGAATTTGTTTTGAAAATTGCCCCCATG
CATCAATGAGTGCTGCCGCATGTGGACATCCTTTCTGTAGTGTATGCTGGAGAGGTTACATTAGCACTGCTATAAATGATGGTCCAGGATGTCTGATGTT
GAGATGTCCTGATCCATCCTGTGCTGCCGCAGTTGGACAGGATATGATTAATTCGCTGGCTAATGAAGAGGATAAAGAAAAGTATGGGCGATATCTTCGC
AGATCTTACATCGAGGATAATCGAAAGACAAAGTGGTGTCCTGCTCCTGGATGTGAATATGCAGTAGAATTTGTCGTGGGCAGTGGCAGCTATGATGTTA
ATTGCAATTGTTCATATGGGGTTCTGTTGGAATTGCACTGAGGAAGCTCATCGTCCANTAGACTGTGCCACTGTTTCAAAGTGG
page-top