Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig7329  (registered. 2007)
Contig Information
Length 546 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit conserved hypothetical protein [Streptomyces pristinaespiralis ATCC 25486] >gi|197926781|ref|ZP_03191727.1| ABC transport system integral membrane protein [Streptomyces pristinaespiralis ATCC 25486] >gi|197723285|gb|EDY67193.1| conserved hypothetical protein [Streptomyces pristinaespiralis ATCC 25486]
Score 87
Evalue 0.34983
Total Hit Count 4
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig7329
CCCATGTGTTAACTACTCTGACAATTGTGTATGCAATTTCCTCTCTCTTTTCTCTTCGCCTTCCAGATCTCTCATCGTACCCAAATCTTCCCCTCTAGAC
GCCATGATCTACCAACGGAGAGGCACATGTTTTCTCGTCATCACCGTCATGCTCCTCCTCCTACCTCTGATGGCTTCCTATCCATGTGTGGCCACTGCAC
ATGACCCACTGCGTCATGCTCCAGGTGGAGACATTGGTGTGTGGGGTCGTTCAGATGGGCCACATCATGAAGGGGAAAAGGTGTTTGGGATGGGGGCTGC
GAGGCGCTTGGGGCAGAGGAAACCGATGAAGAACCCTCCCTCGCCTGTCCCCAATGAAAACATGGGGGTGGTGTTACCCCTGACACCGCCACCACCGTCG
TTGATCAATAAACAGGTGTTGGAGGTCCGGGATACGAGCATGCCATGTTGACTTTCGTGCACCTCCTTATCTGTTGTTGTTGTGTTATAGGAATAGTTTC
GCTATTGTGAAATAAGTTGGCATGCTTCAAAGTGTCAAAAAAAAAA
page-top