Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig7320  (registered. 2007)
Contig Information
Length 614 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_13812 [Oryza sativa Indica Group]
Score 257
Evalue 8.95556e-21
Total Hit Count 7
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig7320
TAATTCGCACCGGCACACAGGAGCGGCAGTAATGGCCGCGTGGTGCCGGTGCCAGTGCCAGTAGCACGCAGGCAGGTCAGGGGAGCAGCGCCACTGCACT
GGGCACTGGTGACGCTTCGAGCCCACTCGCCACACCCTTCCCTCCCTCCCTCGCTCCCTTCGCCTCCTCAAGCCGGGCTCCCAATCTCGCGAAGCGGCGG
CCCTCATTGGCCGGCGGCGGTGCGCGGCCCCGGTCGTTTCCTCCGGCGTCAGGTGCCCGTGATCTGGTTGTTGCAGAGGCGGCGAGGTGAGGTGACGCGG
CGGCGCGATGAGGTGGCTCAAGTCGTTTGTTGGGCTGAGGAAGGTGGAGAGGCAGCAGCATCAGCAGCGCCGCAAGGAGGATGGCGACGCCGGCCGAACA
AAAAGGGATGCCGTCGATCAGTTCCACTTCCAGGATCAGCACTCCCAGGATCACGCTAGCCTTGTCGGACCAGAAGAGTTCCCTGATGGAAATGTTCCGT
CAGAAGACGATTGCAGCACACCTTCATGCTCAGGACCTGGTTTCAGTACACTTAGCGTGCCACTGCCTCAAACANAATAGGAGCTCAAAGAGATCTGGGC
TGCCACAATTATTC
page-top