Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig7318  (registered. 2007)
Contig Information
Length 764 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit GJ20866 [Drosophila virilis] >gi|194144027|gb|EDW60423.1| GJ20866 [Drosophila virilis]
Score 93
Evalue 0.149342
Total Hit Count 13
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig7318
TGCTTCACGGCAGTTAGACGTTCTTGGGTAATCAAGGGTTGGTTTAATTCTTTCTTAAGTCCCCCAATAATTAAACTCAAATTGTCAAACTTACAAGTAC
AATATCCAGATGAAGAAACTCCATCCTCATTTGTTCTTGTGGCTCATCTTGTTGATTTTGCTCTGTTGTCCCCCAATTATTCACGGATGTTCTTCCTCCT
TGCTCCTCGTCAGGGAAGATGAGCCATTCCTCCTCACAAGTAAGCCAGGACAGCAACAATCCTTCTTGATTCCAGGAACCTCTCAATGTCTTCTTCATCA
AGGAATTCATCCTCTGCATCTTGCCCAATGTGTACCTGTTGCAGATTCAAGTTGTAGAACAGGTTTCTGTCCCATGGATTAGATTCTCCTCCACCATCTT
CACTTTCTGCCACTTCATGATGCAAGTCTCCCTCCAATGTCTGCAAAGTATGCTAGTATAATGAATATGAAGAAATTTCCTCCCTGATTTGTTCATGCGA
GAGGGGCAGAGAGAAGCTGGTGAGCAGTTGAGATGCTGACCTGTGGTTGGTGATGCTGATTCCCCTCTGATGATCTTCTTTCTTGCTGCTCGTCAGGTGA
GATCTGTCCTGCGATTTGCGGGAGAGGTTTGGCCCTTTTCGTGGGTTGCAAGTTGGGCACATGCTGTGTTGCCCTGGAGATCGAGAGAGGGGTAGGTCCC
TATTTTTTCTGGAGTGGTTTGTTGACCAGGGTTACCGGGACAAATATTTTGCCTGGCCCGTTTT
page-top