Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig7277  (registered. 2007)
Contig Information
Length 952 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_SHDr Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os06g0359400 [Oryza sativa (japonica cultivar-group)] >gi|113595642|dbj|BAF19516.1| Os06g0359400 [Oryza sativa (japonica cultivar-group)]
Score 375
Evalue 4.36064e-34
Total Hit Count 48
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig7277
TTCTTTCCCAAAACCGGCGACATTTTCCTCCCCTTCCAGAAGTACACAGCGCACACCACCACGCCTCGAGATCTCTCGAAATTCGTTCGTCCATGGCGAT
GCAACAGACCAGGGACCCCACCTCCAAGCTCCCCTCCGCCTCCCCCTTCGCCGGCACCAGCCCTCCCCCATACTACCACCACCACTACGGCACCTTCTCC
CCTCCTGCTCCGCCGCCGCCCGTCGCTGCAGCCGCCTACGACCCCTCCCTGAAAGGACGCAGTGCTCAGGGCGTTGTTGCTTTCCCGTGCACTATCCAGC
AGCAGGTCTTCGTGGAGGGCCTCCCAGTCCGGGAGCCGCGGCTGCCGTTCTGCGGCGTCGGCGTCGGCTGGGCTTTGTTCTTACTAGGGTTCTTCTTGGC
TGCAATTCCCTGGTATATTGGTGCTTTTCTTCTATTCTTTGTTGCTTTGGATCACCGGGAGAAGCCTGGATTGATTGTCTGCACAGTTGCTGGCATTTTT
GCAGTAGTCCCTTTCATGCTCAATGGCATAAGAATGCGTCCGTTCTTTTTTTGAGAACGAATGCGTCCTTTCTGGTGACGTTGGAGCCTGGAAGTCATCA
ATCCAGATTCTTGATGGCCTTATTCTGTCATGCTGGAAGTCGGCAATTCAAATCCACATGTTCCTCACCATATTTGTCATGTCTATAGTTGTACCATACG
GTTCATCCATGTGAATAACACAATCAATTATCCTATATCATTCACAGGGGCGTATATATGTGATCTTCTTTTTAGAAAAGGAGGACGAACCCCGGCCTCT
GCATCTGGGAGATGCATGCAGCCACTTTATATATATGTGATCTGTGTGTTGAATTGTTAGTCCAGAAATTTATTTTCTGAGATATAGTAATATGTTGTAA
CTGTGGTAGCAAGATCGTTTGTTTGAAGAGTGGTTTTTTATGGAAACAAAAT
page-top