Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig7184  (registered. 2007)
Contig Information
Length 548 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_VABA Shoot with ABA treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Paramecium tetraurelia strain d4-2] >gi|124397516|emb|CAK63020.1| unnamed protein product [Paramecium tetraurelia] (no hit)
Score 102
Evalue 0.0271352
Total Hit Count 0
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig7184
TGGGCTCTCTCCAGATCCCCTTTCCCTCCTCCTCCACGACGCGCTCGTCGCCGGCCACTTCGCCCCGCCGCGACCACCGCCGCCCCCGCACCTCGTCGAC
ACGTCTACGAGGTCCACCATCGCCCTCTCCATCGGTTGGTGCCGCGCGTTGGAGCTCCTCAGCTCTGCATCACGAGATCGCCGTCGTCTTCTTCCTCTTC
GGTCGCCGGCGTCGTCGTCGATTCCGACGAAGCCTGCAGCTCCTAAGCCTCCCAACAGCCTCCGTGTGCCTCTGTGATGTCGGAGCCCAGGAGCCAGATG
CCACCGTCGATGCCTACTACGTGGAGACCGCCGACGACCAGGAGTAGTTAGGAGGCTCCCGGGCAGGAGGCCTTGCCTTTTCGATCGTTGCTACTTTTGT
GCTAGCCTTCTTAAGGCAAACTTGTCTAACTTATGTCTGTACTCAGATATTGTTGCTTCCGCTGACTCTTGTGTATTCGAGCTTATGTATTCGAGCCCTC
GAGGCCCCTGGCTTGTAATATAAAGTTTGTATTATTTTAAAAAAAAAA
page-top