Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10225  (registered. 2012)
Contig Information
Length 956 bp
Clones alternative view 6 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 1
Wh_VABA Shoot with ABA treatment 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XA Root 1
WH_XD Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|68655456|emb|CAJ01706.1|| S-adenosyl-L-homocysteine hydrolase [Hordeum vulgare subsp. vulgare]
Score 429
Evalue 3.00E-118
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig10225
TTTTTTTTTTATGAGCAACAGCTTGCGAAGGATTTCAGACATGGCAGAACAAACGAGACAAAACTGTATCTGGAAAAGCACACCTCCTCACTCAAACCAA
TAATAATGCCATTATTTCTGGGCAAAAGCAAACGCCGCCTCTCCCAACCCTCACAAGGCTCAAAACATAACCATAATAACAAATCCTCCGCCTAAGAGAC
AGCATGTAAGATAATAGAAGGGAAACAGGATAGTTGATAGAGTTCCCGTTGGTGCCGCTGCTCCGACTCAGGCTCAGGCCAGCCGCTAGCCGTGCTGGAC
ACACTAGTACCGGTAGGCCGCAGGCTTGTAAGGACCCTCAACTGGGATGCTAATGTAGTCAGACTGGGACTTGGTGAGCTTGGTCAGCCTGGCGCCGAGC
TTGCCCAAGTGGAGGGCCGCGACCTTCTCGTCGAGGTGCTTGGGGAGAACGTACACCTTCTTCTCGTACTTGCCGGTGGCCTTCTCGTTCCACAACTCAA
GCTGAGCAATAACCTGGTTAGTGAATGAGCAGGACATGACAAAGCTGGGGTGGCCAGTGGAACATCCAAGGTTCATCAGACGACCCTCAGCAAGAACAAT
GATGCCGGTCTTGGTCTCGGGGAAGACCCAGCGGTCAGTCTGGGGCTTGATGGTGATGCGCTTGACACCAGGGTAGGTCTCAAGGCCGTTCATGTCAATC
TCGTTGTCAAAGTGACCAATGTTGCAGACAATGGCGTTGTTCTTCATCTTCCTCATGTGGTCAACCATGATGATGTCCTTGTTTCCGGTGGTGGTCACAA
AGATATCAGCCTCAGAGACAACATCCTCCAAGGTGAGGATCTGGATGCCCTCCATCAGGGCCTGNNNNNCACAGATGGGGTCAATCTCTGTCACGATCAC
ACGGGCACCAGCCTGCTTANGTGCGGCGGCACAGCCCTTGCCAACATCACCATAAC
page-top