Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig6951  (registered. 2007)
Contig Information
Length 883 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_PCDAM Anther at meiosis 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Lipase, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|125537175|gb|EAY83663.1| hypothetical protein OsI_38888 [Oryza sativa Indica Group]
Score 186
Evalue 7.89854e-25
Total Hit Count 58
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig6951
CATGGAGCATCGAGGAGGTCGCGTTCAATGTTCCCGGTCTCTCCATGGACTGCTTCATCCCACCCACTGATATCAAGTCTGGGTCCATCAGTGAGACTGT
TGAGCTTCCCGCAGAGTGGGAAGAGCAAGGCCGGCGGTCTTCTCCCATGCCATGGTGCCAAGGTTGCTGCTCTAGAGAAGGCCGATGATAATGTTGCGTG
GAGCGGAGCCCTGCAGCGAGATTGCAAGTGATTTCCTGGTCTGTTCATACTGCTGCTTGCAGTACTACTGACTCATTTTGATGAATGTAGGGTAGAAAGA
GAAGGGCTAAAGGAGGATTTGGATCTTTGAAATTCCAAATGCCCCCTGTAAATAGGGAAGGTTAAGCAGTCACATGGTCTTCCTCTTCCATATCCCTGAC
CCTGAGGAGAGGCCCTGTGTGAAGAATCCTTTCTGATCTCATTCAGAGATATGGTGTAGTAGGTAGTCTTTCTGGTTTTTTTTTGCCAGTGCCTGTGGAA
GAAGAACCAGGGGTGTTCTCCTCCATCCAGCCACATGATTAACCATCATGGTGGTGGCGCTGCTGTTTCCTTGGTAGCAATACTAATTATCAGAGGCCAG
CGAGGAAGAAGGACTTCTTCGTCGGCAACCGAGAGTGATTTCATCGTTCCTAATTAGCAGTCCAGTGTGCTTTGGTTTGTGATAGTCTCTGGTCAAACTA
ACTTTTAGGGGAGACTGGAAGGTCCAGAGTGGTTGTTGCTCTTATTTTAATAGTGTTCCATATCATGGGTCTGTCTAGCTGTTTTTTTCTTTTCTCCCTT
TCTCCTTCACACATCTCTCTTTATTTAGTATGAGATGGTGGTGATTGTATTTTACAGGAGCTGCTGATGTATGCCAAAAACTC
page-top