Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig6934  (registered. 2007)
Contig Information
Length 722 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_PCDAM Anther at meiosis 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_006954 [Oryza sativa (japonica cultivar-group)]
Score 395
Evalue 1.28348e-36
Total Hit Count 18
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig6934
TCTGGGGATCAAGAGAGCACGTGCGCCCCTGGTCCCAGTCAGAAGGAGAGCATCTGGTCGTGATGGATGACCAGGTGTGTATTGTCCGGAACCTTCGCAA
CGGAACCCCTCATGGTAGTGCCCTGGAGATTTGGGGGCTACTGGATTACGGCTCTGGTGATTGGACGCTGAATCATCGAATCGATTTGTTCGGGCACATT
AGAAGAGAATTAGGCGAGCCACAGGCTGTGAGAGTTATTGGTTCTCTTGGCAATTGCAGGTCAGGGAAGAAGATTGTCATTGCTACTAGCAAGCACTGGG
TTTATGAAAAGTTTCATAAAAAGGTTTACACCTATGATCCTAGCTGTCAGGTTCTAGAGGGCATTCTTTCGGTCACTGAGACACACACCTCTGTTCCATG
CTTCATCCCTGGTTCAAGATTCAGTTTATTTGAAGAGAGCCTTGCTCCAGTGCATAAAAGGGATGAAGAGGTTGCCCTGTCATCTACCCTGGCTAAGGCA
ACTAAAGAAACTACTACTTCCAAGCTAAAAGGTTAAAAGGCGAAAGGTCAGTATTGTGTAAATCAAGATCGGCATCTCCATGGCGTGTATTCTCAGGATA
TCAGTTAGCTGGTTTCGAATGTGTGCGGCAGAAATCAAGAGCTGATAATGCATATAGTACATGTAGAATGGCTCCAGCTACATGAAGAATCGGGTGTAGG
CTTGTTTTGCTTTGTTCTAAAA
page-top