Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig6886  (registered. 2007)
Contig Information
Length 1150 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_PCDAM Anther at meiosis 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit OSJNBa0088I22.8 [Oryza sativa (japonica cultivar-group)] >gi|125591338|gb|EAZ31688.1| hypothetical protein OsJ_015171 [Oryza sativa (japonica cultivar-group)]
Score 645
Evalue 1.83178e-86
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig6886
GGCGGCTCCCGGACCGCCCGTCGATCCTCCCCTCTCATTCGGCAGCCCCCCTCGCATCCTCCGAAATCCCCCATTCCCCGGTTCGTTCCTAGGTTCTCAT
GAGCATGGAGGTGCTACATGATACAACAGGGAAGAAGGAAGCGGTTGTGTACTATATGGATGCCCCCTTGCCATATGCAATTGAAGAGAATTTCGGGGGA
TGCTTCTTTGAAGATGATGTTGATCTTGCACAAGTTCTTCAAGATCAGGAAATAGTGTATCAATTAATCCAAGGAAATGATGGAAGTGGTTTATCCCAGG
ACTCATTCAGATCCTGGTTCTAGTTGTGGCCATCCACAAAAATCGAGTGGGCGAAGATTAACAAGAGGCGCAAATTATGAGTCACAGCTAGCTGTCGATG
AAGCTTTAGCTAGAGACTTGCAGGCGATGGAGGACCAAATTGCTAGGGCAACGATAGATGACAAGAAGAGAAAAGAAGGAAGAAAGCCCGTAAGTTCTTC
AACATCCAACAATGGCAATACTTCTGTGAGCAGATCTTCTCAGGTATTAACGAAGGATGAAGTTGATCCTGATAATATGACTTATGAGGAACTACAACAA
TTAGGGGAAACTATTGGGACTGAAAGTAAAGGGTTGCCAGAAGATGTGATAGCTCTCCTTAAGTCTTCAACATACAAAGTTGGGATATTCTCAAGAAAGG
AAAAACATGATGAATGTGTGATATGCTGTATGGCTTACAAGAACCGCGATAAGCTGACTACATTGCCCTGTCAGCATCAGTACCATCGAACTTGTGTTGC
CAAATGGTTGAAGATCAACAAGGTATGCCCCGTTTGCAACAAGGAGGTTTTTGGGTCGTGACAGCGAAGACCGTAGATTCACCCGACGTCCAATGTCAAC
ATGCTTCAGAAACGCTGTCACTTACGCAGGCAGGCCGCGAAAGAGGCAAACTGGATGTACTCTTTAGTTATCGTATAAGATGAACTGGAGCTTCTGTTGC
ATCGCCAGCAAAATAAAGAAGGCAGATGCTCGTGTTGAGTTTAGCACTTTAGCTGTTATGTGACTTGGAGTAATGTATTTCCCACGGGTTTCAAGCTTGG
CGCCTTTCTGTATTGCACCATACTGTAGATTGTGTGTAGTCGTGACCTAT
page-top