Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1020  (registered. 2012)
Contig Information
Length 659 bp
Clones alternative view 10 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_h Spike at heading date 1
Wh_DPA20 Seed DPA20 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_OKCS Seed DPA5 1
Wh_SHDr Shoot grown with dessication 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115445683|ref|NP_001046621.1|| Os02g0301100 [Oryza sativa (japonica cultivar-group)]
Score 283
Evalue 1.00E-74
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig1020
ATTCGGCACGAGGGACAGAGGGAGAGGGTCCGCTGTACTTGCATCCTTCCCTGCCCCCTTCCCCTCCTCCCCTCCAAGTCCAGAAATCCGTTCCCCTCTC
CCCCTCTCGTCTGCACCCGAGACGCTCCTCTAGATCAGTTCCCCCTCGGTGCGGTTACCTCTCGCCGGAAGCCAAGCCACCATGGTGTCGCCGGACGCTA
TCCGCACCGTCATCGGCGTCATAGGCAATGGAACCGCCTTGGTGCTCTTCCTATCCCCAGTGCCGACGTTCATCAGTATCTGGAAAAAGAAGACGGTGGA
GCAGTACTCGGCGGTGCCGTACCTGGCGACGCTGCTGAACTGCATGATGTGGGTGCTCTACGGGCTCCCGCTGGTGCACCCGCACAGCATGCTCGTCATC
ACCATCAACGGCACCGGCATGCTCATCGAGCTCACCTACATCGCGCTCTTCCTCACCTTCTCCGTCGGCGCCGCCCGCCGCCGAGTCCTCCTCCTGCTGG
TCGCCGAGGTCGCCTTCGTCGCGGGGGTCGCCGCGCTCGTCCTCTCCCTCGCCCACACCCACGACCGCAGGTCCATGGTCGTCGGCATCCTCTGCGTCCT
CTTCGGCACCGGCATGTACGCCGCGCCGCTCTCCGTCATGAAAATGGTGATCCAGACCA
page-top