Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig6834  (registered. 2007)
Contig Information
Length 1118 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_RDr Root of dessiccated seed 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0467000 [Oryza sativa (japonica cultivar-group)] >gi|47497514|dbj|BAD19567.1| putative cinnamate 4-hydroxylase [Oryza sativa Japonica Group] >gi|113536345|dbj|BAF08728.1| Os02g0467000 [Oryza sativa (japonica cultivar-group)] >gi|125582045|gb|EAZ22976.1| hypothetical protein OsJ_006459 [Oryza sativa (japonica cultivar-group)]
Score 958
Evalue 2.2728e-161
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig6834
TCCTTTTTTAAGAAAAAAAATGTAAACCCCATAAATCAACTGACATACTTTCGTGTAATCTACTGTATTTGTAATCTGAAGAAAAATTGTGCTTGTGGAT
CAGGCTATTGGGTTGAAGATGCAATTGCTCAGGGTGAGATGGGGTGGAATGCGACGACGGAATGGTTGGCAATGTGCAGGCTGAACTGCCCGCCTTTCTC
GCTCACGTCGAGCTTGTCCACGCCTGGCGGCGGCACCATCTCGAAGCTCCTCACCAGCTTCCCGACGATGAGCGCCAGGATGGGCAGCGCGAGGATGATA
CCGGGGCAGCTGCGCCGCCCCACGCCGAACGGGAGGAACCGGAAGTCCACCTTGCCGCCGACCGTGGCGTCCACGTTGCTCTCCTCGCCCAAGAACCTCT
CCGGCTTGAACTCCTCCGGCTTCTCCCATAGCTCTGGGTTGTTGGCCAGCCACCAGGCGTTGACGACGACCTTGGAGCCCTTGGGAATGGTGTAGCCGCC
GAGGCTGGCCTCCTCCAAGGTTCATGTGGGGGACGAGGAGCGGGATCGGGGAGTGCAGCCGCAGCGTCTCCTTGATCACGGCCTGCAGGTACGGCAGCTT
GCTGATATTGGACTCGGTGATGGGCTCGTCGTCGCCGAGCACGTCCCTGATCTCGCCGCGGACCTTGCGCTGCACTTCCGGGTGGTTCACCACCTCGGCG
AGCGCCCATTCGATGGACCATAGCGTCGTCTCGATGGCGGCAACGTTGATGTTCTCCACGATGTAGATCACGTTCTCCGGCGTGATCTCGCCGCTCTTCT
CTGCTGCGAGGATGTGGTCGATCGCGCATCGGAGCTTGTTTTTGTCTCCTGGTGTGTCCATCACCTTCCTTCTCTTCTCGACGTAGTTGGCGTTGAAGAA
GGCCAGCCTCCTGGTCTGCAGGTCCCTGCACTTGTTGAGGTAGCCACGCAGGAAGGGCCTGAGGATGGGGATGAAGTCGCCGTAGTTGTAGTCGAAGCTC
TGCGCCAGGCGGCTGCGCTCCGAGTTGAACTTGGTGGCCTCCACGAACATTGGGTCGTCCACGGACTCGAACCGGGCGTCGAACATCATGCGGTACATGA
TGTTGTAGAGCATGAGCT
page-top