Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig6812  (registered. 2007)
Contig Information
Length 891 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_SHDr Shoot grown with dessication 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_35554 [Oryza sativa Indica Group]
Score 940
Evalue 1.19664e-99
Total Hit Count 173
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig6812
AATGATAATGATATCAAGCGTTGATGACACACAATAAAAGATATACATGACTCTGGAACAGTACATATACAATGGCCAATATGACAAAGCATTGAAAAAC
TTGTGTAATGACCGCTATTGTTTAACTGAAATCAAAAATTGATTATTGCTAAATACACAGGCTATAGAGGCCAGCCGGCATTGATGGTTCTAGTTTAAAA
GACCAAGATTATTCGCCTTATCCCCTCCTTCTGTGCTGGTGAGCCATCTTCTCGGCGTGGGCCTTCCTGTCAGCGTGGGCCTTCCTGTCGGCGTACATTG
GAAGGCTACTGATCTCATTCATCTCGCCCAGGAGCTTGTCTTCAGTAATGTTATCTGTGATGCTCCTCATCACCTTTCTGTAAGTATTGATATCATTAGG
AGTTGATTTATCTGCTCGGATTCGCATGCAGAACCAGCAGTCCTCCTGTTTATTCCAAGAGCACTCAACAATTTTCCCTGATATTGAAGATGGCTCTACA
TCATCAGCAAATACCACCCGGGTACCATCCATAAGTTTCTTTTTGCCCCTCTCATACAGAAAAATAAGCTGACGGTTTTCACTACCAGTCTCAAACAAAA
AGTCAACTGAATTCATCTCTGGGTACTTCCATTTTAAAAGACCTTCGTGCGTACGATTCACGTATGGATCATCCCAGCCCTGAAATATAAGCCCATCAGA
TTCATGTGAAAGTGCTGGAATAAACTCCTTGAGTAATTTCTTCACCGTGGAAAGCAGCCAAAAATCCTTTCTCCTTACCGAAAAAAGTTCCAGGTCATAT
CTGTATGATGGATTGCCTTTCAGACCAGTTTCAAACTGCTTTCTCTCATAGATGCGTGGACGAATTATTTCATCCTCAAGTAGCTTCCACC
page-top