Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10189  (registered. 2012)
Contig Information
Length 986 bp
Clones alternative view 84 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_f Spike at flowering date 2
Wh_r Root 2
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 2
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_RDr Root of dessiccated seed 7
Wh_SHC Shoot grown with cold treatment 3
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 9
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 4
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 4
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 4
WH_XN Leaves, plant was grown at constant 23Ž 4
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 6
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 3
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 4
WH_XA Root 6
WH_XC Root, treated at 50 microM Al for 6h 10
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 1
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|20067423|emb|CAC94005.1|| glutathione transferase [Triticum aestivum]
Score 459
Evalue 3.00E-127
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig10189
TTTTTTTTTTGGACGAAGCTTCAATTTATTCATGAAACCACATGTCAACAACTCAGATCGAAGAGAGTGCACGCATACGCGCCATCCATGACGAGGAGAC
ACTAAGGACCTAGTAGTAACAACAGTTCAACTCTTGGGGTGAAAACAACTCAGAAGGCAGAGGAATTATTGGATTGACACGATCCTCCGCCGCTAGTGGG
ACGACACGATCTTTAATTAGTTACCGGTGACCGCGACGTTCCACTTTGGATAAAGCACCGTAGTGATGTACTCCTCCAGCTCGTCCACACCAGGCAGCAG
CGCCTTGACCGGCTCCGCGACCCTGAACCGCTCCGCCCACGCTGCTAGTTTCGGCGTCCTCGCCGGGTCGATGAGCGGCCCCAAGCCGGCCAGACGGCCT
ACTGCCTCAAACCAGGGAAGATAGCACCCGAGCGCGATGTCGAGGAACCCGATGGAGTCACCACCAAAGAACGGCGCCTCCACCTCCCCTTTGGAGCACT
CTGCGAGGACACCTTCCAAGTGTCGGAGCCCGGACAGGGTCTCCTCCACCTTACCGGCTCTCTCCTCCTGCTTCGTTGTCTTGAGGCTGCCGATGCACGA
AGGAAACAGCTTGTCGTTCACATAGGCGGCCCAGAAGCGAGCGACGGCGCGGCTGTAGGGGTCTGCGGGGAGGATGGGCTTGCCGTTGCCGGCAAGGCCA
ACGGCATCGTCGAGGTACTCCAGGATGAGCAGCGACTCGCAGACGGGCCTGCCGTCGTGGATGAGGACGGGCACCTTCTTGTACACGGGGTTGGACGCGA
TGAGGAGGTCGCTCTTGCACCCGCGGTCCTCCGGGAGGTACTCGTAGCTCAGCCCCTTTATGGCGAGCGCCATCTGTGCGCGCAGCACGAAGGGGCTAAC
CCCGGGCGCCCACCACCCCAGCAGCTTCAGCTCTTGAGCGCCGGCCATCAACGTTTCCTCGTCTTCCTCCCTGATACTCCTGTCCT
page-top