Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig6734  (registered. 2007)
Contig Information
Length 1005 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_V483 Shoot grown under cold condition for 3days 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unnamed protein product [Vitis vinifera]
Score 92
Evalue 0.313653
Total Hit Count 21
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig6734
TAGGTTTTTTTTATAGTGCTGATCGAATTCGATAAATTTTTACTTCGCATAAGTTCGGGCAAGAGAGTAACTGGGCCTGCCGATACTGGGTTTAGAGAAA
CCATACCATAGTTCTATCCTCAAACTAGGGTTAGGATTTGTTTTGACGGTAGTGGCCAAAATGGTTATCAATAGAATAGGGGTGAGGTAGTGTTTCCTTA
TTCTTTTATTATATGAATTTGAATTGGTTCTTAATTGAGATTCGATTTGATAATTTTAAAATACGAGGATAAGATGTCAGAAATCTTGGTATCCAAAGAA
AGGTCCCTAAGGGGCATTCTTTTTTTTTCAATCTAAGATTCAAGAAGGGACTCCACGAAAGAATATCAAGACTTACTAATTATTATACATTTTTTTATCG
TACATCTTATGTTACCTACATACACTAAAGTAAGGACTACTTAATTCTAACGAGAATCAGATTAAATAGGTCGATCAAAAATCAATTTAGGAGTTGTGAT
AAAGTCTCTTCATTCTTTCATAGAATGATACAAAGCAAGGCTGCAGGGTTTAGGTCAAAAATAAACATAGGTAAGGTAGGTATCCAATAAATATTTATCT
ATCGATAATTTTATGGTATATTCGGGCGTCCTTTGCTTAAAAAAAAAGAGTAACAAAAGGAATAAAAAATCTTCCTATTCCCGCTTCTTCTATTCAGGAC
ATCATTCCCGTACTCTTTCTTTTTTAAGGAAAAAAGGGCTATAGTATCGTATTTTTAATGCTCTCTAATTCTACCAGAATTCCTATAAGAATTTGTTAGG
AGTAAATTCCTTGAACTGATTGATCCATGGCCTTAGGGCGGAATCCCTTTTTGACTCTGTACCCTTGATTCCACTATGATTATTGATCAATAGTAGAATA
ATCCCTTCATAGAAATAGGAGACATAATTTAGATGGATATAGTAAGTCTCGCTTGGGCTGCTTTAATGGTAGTCTTTACATTTCTCTTCACTAGAGATGG
AAGAG
page-top