Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10183  (registered. 2012)
Contig Information
Length 1021 bp
Clones alternative view 37 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_yd Spikelet at late flowering 3
Wh_CSEC Callus 9
Wh_EM Dormant seed with water absorption 3
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_MS Seed DPA5 of DT3DL CS wheat 3
Wh_PCDAM Anther at meiosis 1
Wh_SHDr Shoot grown with dessication 2
Wh_VSCB Liquid cultured tissue 4
Wh_VWD Shoot grown with dessication 2
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XA Root 1
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XE Seedling, infected with leaf rust 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|194702330|gb|ACF85249.1|| unknown [Zea mays]
Score 413
Evalue 2.00E-113
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig10183
GAGCCAGAGCTTGACTCCTCCATGGAAGATCAATGCAAGACGATGACTGAGAAGACAAGTACAACGGAGAAGATTTTTTTTTTGAAGATCAACCTATAAT
AGTAGCTCGCAAAAATACTGGCACTCAACAATATGCCCAACTGGGTCAGATCATATATTTGAGATTCCTGTCGGATTAAGGGTACAAAGGCATGGCACAA
AACCGTCTGAACACAGCTAGACAACAAGCACGCCACCATGATCCAACAACCTTAAGAAGACTCGTCAGCTTCCTCACCTCCCAGGTGCGCCAAGCCTTCC
TTGTACACTTCAAAGTCGTCCGAGGACCAGCGGCAGACAAGGTACAGTCGGAACGTCGCCATCTTCGTCCCAAGCACGCGCAGAGTGTGCGCTGCTTCTG
GTGAAAGGGGCTTTCCTTCTTCACATACTACATGATCTGCAACCAATTCAACAACACCTTTGTTTAGGCGAACTGGCAGTCCTTGCTTGCGCAGAAAGGG
CTCCATTTCATGTGAAAACTGTTCCAGAGGACCTTCCTTTAGCTCAACCGTTTGAGTAGCAATACTTCCTGTCCTCGCAAAATCATTCACCTCAAATTCT
CGGAATAATCTCTCGACATCATCCCTTGGGAGATTGGTAAATAACAATCCAGAAGCACCTTGAAGGAACTTGGAGAGTTTATGCAGGCCTGTCTTAGCTT
CATCAGCAGGTGACCGCCCCAATGCTATCTGCATGACCTTCTTTCCAGCAAGGAATATCCGGCTAGAGGACTTGAGTTGGTCCCTGAGGTCCTTGAGCTT
CTGATTCCTCATATTGTTGTAGGTGAAGACATAGGCGCTGCTGTGGCGCTCAATGGCGTCTTTGATTTCCGTGACCACCTTGCCCTTACGCTCTAGCCCC
GGCTTCTTCTTGGTCTTTGACAAGGTGACTGAGCGATTGCGCTTGGATTTCGGCATGGCGGAGGCTTGGAGTCCTCTTCCTTGGCTGCTGTCCTGGGAGC
AGCGGCGGCGGCGGCTGTGCC
page-top