Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig6624  (registered. 2007)
Contig Information
Length 835 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_37521 [Oryza sativa Indica Group] >gi|125578547|gb|EAZ19693.1| hypothetical protein OsJ_033902 [Oryza sativa (japonica cultivar-group)]
Score 703
Evalue 3.24035e-72
Total Hit Count 253
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig6624
AGGAAAAGATAAACAAGATGAATGCTCGAAACATTGCTATGGTTTTTGCACCAAATATGACTCAGATGGCAGATCCTTTGACTGCACTAATGTATGCAGT
CCAAGTGATGAATTTTCTGAAGATGCTAATAGAGAAGACCCTGAAGGATAGAGAGGAGTCCAATCTGGACGATGTGTCTTTGCCCCAAAAGGACCCGTCT
GATGAAAACGGGCATCATAACCCTGGCTTTGCCGTCGATGCTCACCGTGCGGAAGGATCAAGGCGTCCTTCTTTCTTCAGCGAGGAACCCCTTCTGAACA
GCCCTGCACACAGCACCGAAGACAAGCCTAACGAGACCAATCCTACCGGAGGAGACTCTGCACCTTCTGGCCAGAAATTCATGAACACAGAGGGCTCTTG
TCGATGGTCCCAACCTCTGCCTGCTGCTTCAGCCACCACTGATATTTCCTGTGCTACAACATTGAACTCACTGCAAGGCAAGGGGAGCCGTAGCCTGAAT
AGTAGTAGGAGGACAAGGAAGGGCAAGGGGCAGTCTGCAACGCCCGCCGTCGCTCCGCCAACCGAGAAAAAATCACGAGGTGGAAGCATCGTGAGCCGGT
TAAACTCCACGGTCGAACGGATCGAAGCGTGGAGATGAATGAGCTCAGATGCTACTGTCGACCCTCTTGTGTCGTAGATGACTGACCCGGTGTGTTCCTG
CGTACATGATCGACCGAATTTTGATGTGGTTTTCATTTCCTGTCAGGTCATGATCGTTGTATTCCTTTATTTGATTTGCTTCCACACGTACGCTAACTTT
TGTATCTTGCTTATCAGTTGTACTTCTCACTGTTT
page-top