Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig6619  (registered. 2007)
Contig Information
Length 1120 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_VWD Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0106000 [Oryza sativa (japonica cultivar-group)] >gi|24418034|gb|AAN60484.1| Unknown protein [Oryza sativa (japonica cultivar-group)] >gi|108705736|gb|ABF93531.1| Uncharacterised protein family containing protein, expressed [Oryza sativa (japonica cultivar-group)] >gi|113547153|dbj|BAF10596.1| Os03g0106000 [Oryza sativa (japonica cultivar-group)] >gi|125542059|gb|EAY88198.1| hypothetical protein OsI_09646 [Oryza sativa Indica Group] >gi|125584614|gb|EAZ25278.1| hypothetical protein OsJ_008761 [Oryza sativa (japonica cultivar-group)] >gi|215693273|dbj|BAG88655.1| unnamed protein product [Oryza sativa Japonica Group]
Score 894
Evalue 3.74154e-94
Total Hit Count 306
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig6619
ATGCGCGTCCTCGCCGGCGCCACCGAGCTCGCCGGCATGGTCATGCATTCCTGCGGCGCCGGTGAGCGCGGGGACAACGACACCGGCACCGGCGCGCTCG
TCAACTACATCCTCGCCTTCCCCGTCGCGCTCAAGTGTCATATAACCAGCAACTCCGACATCAGAAAGGACCTTCAGGGCTTGCTCGCAGAGGACGACCT
GAATGTTATCATGAGCTCAAAACACCGGCCTCGTTGCATCATCGAGTTCATTTCGCAGAGTCTCCAGATGTTGGATTTCGAGGAGCATAAGCGGAGCATC
ATGGAGTCTAAACTGTCTTGTTTCCTTGAAGGAATTTGTGTGTGCGAGCAGATCATCGGGATTCCTGTTCCTCTGTCGTACACGAGGCTTACTTCGCGGT
TTCTTGTCCTGTGGCATCTTACACTTCCAATCATACTATGGGCAGAATGTAAATGGATCGTGGTTCCAGCTACTTTTGTCAGTGCTGCCTCCTTATTCTG
CATCGAGGAAGTGGGTGTTCTCATCGAGGAGCCATTCCCGATGCTAGCGCTCGACGCGCAGTGCCAGCAGCTCCACGACAGCATGCGCGACATGATGTCG
GTGCAAGGCCTGGTCAGAAAGCAACTGGTCGCCAAGACCAAGGGCCACGGCAGAGGCGGTAGGCTCCCGCAGAACGGCTGGCCCGTCTCCAGCTCCAGGG
GCGAGCAGGTGAAGGTCGACTGATCGAGCTGGCTGGCGGCGAATCATGCACAAAGCGGCGGTTGGAAAGCAACCGAAGTGTCTGTCTGGGGTTTCTGGTG
TGCGGTCCCACTTCCAGGTAGATGATGCTGCTGTTGCAACGAACAGCAGCTTCCCAGGTCCACCGTGTGAGAGTTAGCACCAGATGGTCCATTGATTTGG
TGTGGCTGAGCAGGGTTCCTGGGTTGAGTGAGCTGAGTGAAGCAGTAGAATAAAGTGGTGAGGATGTAGTGTAGTGTAGCCCCGGCCTCACTTGAGTTGG
TAGGTAAGTAAGGTGTACCAGCAGCAGCAGCAGCAGCATCTAGTGCATGTAGTAGAAATGAAACTGGGTCCCCAGCTTTGTATATAGTCCTGGTGAGCTG
TTTATTTGTNCTGTAAGAGT
page-top