Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig6600  (registered. 2007)
Contig Information
Length 889 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 23.5 kDa heat-shock protein [Triticum turgidum subsp. durum]
Score 965
Evalue 1.51024e-102
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig6600
AAACCATCACAGCAGAGAGAGGGAAAGAAGAGAAGAGAGAGAGAGAGAAGAGGCAGAGAGACCATGGCTTCCGCCGTCGCTTGCAAGGGTGCCGCGCCGG
TCAGCCCCCTCAAGTCCGGTGCTCCCGTGACCTTCTGCCCGCTCCGCTCCCCCGCCGTCACCGCCGACCGCCGCCCGTACAACACCCAGGTCAAGGAGGC
CAGCCGCTACGACGACGACAACGACTACAGCGGCCGCGACCTCGTCATCCCCAGCTTCTTCTCGCAGGACGTGCTCGACCCACTCAGCGCGCCGACCAGC
ATAGCCCGTCTGCTGTCTCTCATGGAGGACGTCGCAACTCAGACCGGTGGCCTCTCCTCCACTGCTGATGCTGGGGCGTCGCGGCTCGGACGGTGGGTGG
CCAAGGAGGACGACGACGCGGTGTACCTCAAGGTGCCGATGCCGGGGCTGACCAAGGAGCACGTGGAGGTGCGCGCGGACAAGAACATCCTGGTGATCAA
GGGCGAGGGCGAGAAGCAGCCCTGGGACGGCGACGACGACTCCGCGGTGCCGAGGTACAACCGCCGCATCGAGGTGCCCGCCGCTGACGCGTACAAGATG
GACAAGATCAAGGCCGAGATGAAGAATGGCGTGCTCTGGGTCACCCTGCTCAAGGTCAAGGAGGAGGAGCGCAAGGACGTCTTCCACGTCAAGGTCGAGT
AGCTAGTGCCGTCGTGGTAGTGCTCATGGAGGATGGCCGGCGCGAGAGTGTGAGAGACGCCTTGTTGATGTGGTCATGTTTGGTGTCTTCCTGCCCTGTT
TTGCTTCTTTGATCGTCTTGGATCGATTAGCTAGTGGTCTGGTGGTGAAGTTGGTCGCGAACTCTGTTAATATCCTCTAGTTCGGCATA
page-top