Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10169  (registered. 2012)
Contig Information
Length 972 bp
Clones alternative view 64 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 2
Wh_KMP Shoot grown under continuous light 4
Wh_RDr Root of dessiccated seed 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 4
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 6
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 6
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 3
WH_XR Roots, 18 day old plants were grown hydroponically 6
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 3
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 10
WH_XD Root, treated at 50 microM Al for 6h 8
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242035279|ref|XP_002465034.1|| hypothetical protein SORBIDRAFT_01g030930 [Sorghum bicolor]
Score 344
Evalue 1.00E-92
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig10169
TTTTTTTTTTGTTTTTTTAAGAAAAAGGAAAGCCGCAAATAAAATAAGTAAAATATAGGAAATACTAGGCATCTCTGTTCGGCACGGCATAATGCAGAGC
TGCCTAAAGAAGAATAGAAGATAGTGACACATTAACGTATTATATGGATAGGCACACAAATTCCACATAGAAAACACAAACAATATACAGAAAACATTAT
ATGGTGGTAGCCTTGTAGGCACGTCTCTTTAGTTTGTAGCGCCGGCTGCGGCGGCTGCGGCGCGAGCGTGCATCGCCATGGCAAACTCGACCAGCTTGCT
CACGTCCGGCATGACCGCCTCCACCGCGTCCAACGATCCAAAGTTGTCCGCCCACGCAGCCAAGAGCGGAGTCGTGGTGGGGTCGAAGGTCTTAACGCCC
TTCATCTTATCGGCCGCGTGCACCCATGCGAGGAGGCCGCCGAGCATCACGTCCACGTACCCCGCGGTGTCGCCCCCGAAGAAGGGTTTCCCGTTAGAGC
AGTCCCTCAGGGCCCCCTCCAAGGTCTCCACCGCGGCGGCCACCTGCTTCTTCCCCTCGGCCTTCTCCTCCTCCGTCTTGGCCATGGACGCCTCGGACGA
TGCTTTCACGAGCGTGCCGTCGATGTAAGCGGCCCAGAAGCGAGCAACGGCGCGGCCGTGGGGTTCCTCCGGGAGGAGCGAGGAGCCGACGCCGGCGAAA
GCCTCGTCGATGTATTGCAGGATGACCGACGACTCGCAGATGGGCTTGCCGTCGTGGATCAGCACCGGCACCTTCTGGAGCACGGGGTTGGACTTGAGGA
GCAGCTCGCTCTTGCTCTTGAGGTCCTCTTCGACATACTCGTAGCCGACGCCCTTGAGGCTGAGCGCGAGCTTGACTCGAAGGACGAACGGGCTCGCCCA
CATGCCCAGCAGCTTCACTTCGTCGCTTCCTCCTCCGGCCATTGCTGGTGTCTTGATCGGTTCTTGTCCCGG
page-top