Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig6527  (registered. 2007)
Contig Information
Length 688 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_002382 [Oryza sativa (japonica cultivar-group)]
Score 321
Evalue 4.41582e-28
Total Hit Count 85
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig6527
CAAAAGTGGCCCCAAATGCTGTGGTTCCAAGTGTCAAGGTGCTAGCTTTGAAGGTGGATTTCGGAGTGGCCGAGGAAGTGAAGACCCTGCTCAGTTTCCG
GAGATGCTTCCCCCAAGTCGAGACCCTACACGTCATGTCCTCCAACAAGAAGGAAGAGGAAGAGGACGAGCAGGACGAGAAAGACGCGGGTGATGCCAGT
GGCGAGCAGCTCATCATCCCCACGTTCTGGGAGGAGGCCGGCCCGATCGGGTGCGTGGAGTCGCAAGTGAAGAAGGTGGTGCTGAACCAGTTCACCGTGG
GCGCCAACGAGCTGGGATTCCTTAAGTTCGTGATCGCGAGGGCTCAGGTGCTGAAGAGGGTGGTGCTGGTGCTGGACCCCGGGATGAGCCCCACGGCGGC
CAAGGAGGCATTGAGCAAGCTGGCGACGCAGCTGCCTTCCGCGAAGTGTGTCAATGAGAACGTGGAGTTCATGGGGCTCCCGCGCCCAATGGCTCCCTGG
AGCTACCAGATCGCGTCTGATCTCTCCCTGAGCGACCCGTTTCCGGCTGAAGGCGGTATACTGATGCAGCGTCCGTGAGCGTCGAACACTTTGGATGTTT
CTCTCAAGAACTTATTAGGAGTAGCTAGCTTGAAGAACTTATTATGACTCATGTCTTCCATCTGCGCTAGCTTCTTTTTTTGCTGTGA
page-top