Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10163  (registered. 2012)
Contig Information
Length 1650 bp
Clones alternative view 37 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_h Spike at heading date 2
Wh_CSEC Callus 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_RDr Root of dessiccated seed 1
Wh_SHC Shoot grown with cold treatment 4
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XN Leaves, plant was grown at constant 23Ž 3
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 6
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 4
WH_XC Root, treated at 50 microM Al for 6h 4
WH_XE Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125540839|gb|EAY87234.1|| hypothetical protein OsI_08636 [Oryza sativa Indica Group]
Score 714
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig10163
TTTTTTTTTTACAACAGCTCAAAGGATTTTATTCTTTAAACTCCAACAAAAAATAGTACAATACCACTAGTTACTTTATAGGTTTTGGTCAGCTGATAAG
AGAAATCAACAATTAAAATACAAACTCCACGGAGCTCGCTGCGACGGTCCAACAACAAACCCAACTGAGTACAAGTTTCGCAACTCATGATGCTCACCAA
GCTTCCCAACCTTTCTTCCACTCACAATCTGTTGTTCTTCATCAGCTCCACAAATTCACCAAACGCCAAGTCTGAGTCATGGGGCCCTGGGGAGGACTCC
GGATGGTACTGGAGAGACATAAGCTTCATCTTGGGGAACACAAGACCAGCACAGCTCTGGTCATTTAGGTTGATGTGTGTTACTTGTACTCCTTCCGGGA
GCGATTCAGGATCCACGGCATAGTTATGGTTCTGTGCACTGATGTCTACACGTCCGGTCCTGTTGTCACGAACTGGATGGTTTCCTCCGTGATGACCAAA
TTTCATTTTAAACGTCTTTCCACCAAGAGCCTGCCCGATCAATTGATGGCCCATGCAGATACCAAATACTGGAACCTTCCCTACTATTTCTTGTACTGTT
TTCACGGCATATGGAACTGCAGCTGGGTCACCAGGGCCATTACTAAAAAGAACACCATCAGGCTTCAAATTAAGTACATCCGAAGCAGGCCAGCTTGCTG
GAACAACAGTTATTTTGCATCCATATGATGCCAGGCGTCTCAAAATGTTATGCTTGACTCCAAAATCATACACGACGACATGAAAAGTTTCACTTGACTG
ATTGTCGTTGAACTCCCATCCTGAACCGGTCTTGTCTACCCATTCATATGGAGCATCACAAGTAACATCACTTATCAAATCAACACCAACAATTTTCCAA
TTTTTGGCCATTTCCAACAATTCCTCGTCTTTAAGAGACTGGTCGGTACTTAGAACACCAATGAGACTGCCATCTTCTCTTAACCTGCGTGTTATTGCAC
GTGTGTCCACATCATATATGCCCATAATGTTCCTCTTTCTCAAATATTCATCAAGTGTTTCTGTGCACCTCCAGTTGGAAGTACATATACTTAGGTTCCG
TATGATTAAGCCACCAAGGAAGCATTTTATGGATTCTTCGTCACCAGAGTTAACCCCGGTGTTTCCAATATGAGGGTTGGTCATCAAAACAAACTGACCA
GCGTAGCTAGGATCAGTCAAAATCTCCTGGTACCCTGTCAATGAGGTATTGAAAACCACCTCGCCGACTTGAGTCCCGGAAGCACCGAACGATTTGGCAT
TCCACACGGAGCCGTCCTCGAGAACGAGGCGAGCGTCGCTAAGCTTCCAAGGCCTCTCCACCGCTTTCGCCCCCTGATTCGCTGCCGGACTGGCGACGGA
GCGGCATACCACGGGCGTCGTCGTCCTCCCGAAGGTCACTCGGCCATGCTGCCCAAGTCCGCCGATAGAGGGCGGCGCGGGGGAGGTGCGCCGGTGGACG
GCGTGGACTGCTGGGCGGGAAGGGAGGGGGCGCATCTGGGGGAGCATGTTGGGGAAGGATGGGAGGGGAGAGGCTGGGCCTGGGGTGAGTGGGGGATGCT
TGGGCCGCCGCCGCCGCCGCCGCCAGACTTGCTTAGGGTTTTGATTGAGA
page-top