Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig6463  (registered. 2007)
Contig Information
Length 587 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os09g0452700 [Oryza sativa (japonica cultivar-group)] >gi|51535937|dbj|BAD38019.1| putative ubiquitin / ribosomal protein CEP52 [Oryza sativa Japonica Group] >gi|113631570|dbj|BAF25251.1| Os09g0452700 [Oryza sativa (japonica cultivar-group)] >gi|125563958|gb|EAZ09338.1| hypothetical protein OsI_31610 [Oryza sativa Indica Group] >gi|125605917|gb|EAZ44953.1| hypothetical protein OsJ_028436 [Oryza sativa (japonica cultivar-group)]
Score 436
Evalue 1.40891e-41
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig6463
TCAAGGCCAAGATCCACGACAAGGAAGGTATCCTGCCGGACCAGCAGCGCCTCATCTTCGCCGGGAAGCAGCTTGGCGACGGCCGCACCCTGGCCGACTA
CAACGTCCAGAAGGAGTCCACGCTTCACCTCGTGCTGGGCCTCGCCGGCGGGGACAAGGGCTCGTGCTACCCGCCCAAGATGGAGCCTAACCTGCTCGAG
CTCGCGCTCAAGTACAGGCAGCACAGGCTTGTGTGCCGCAAGTGCTATGCACGCCTGCCCCTCAGGTCTGCCAACTGCCGCAAGAAGAAGTGCGGCCACA
GCAATGAGATCAGGCCCAAGGAGAAGCTGCGCTACCACTGAAACATTGGAAACTTGACCCTGGGAGACATGCCATAGCTGGATTAACTGGGAGTTGAAAG
TTTGGTTCGAGTAATCTTAGTTTCTTGGATATGAAGTTTCATCCTAGTTAAATGTTGCTTCTGGAATCTAGAACGCCATAAAGATGCTACCTAGTAGTTG
CTCTTGTATTCTTCCTGTCGTAGTAATGTGCAATTTGTCTTGCGTGAATGGTGAAATCAAGTATTAATTTGAGGTCTACTAGCTGAA
page-top