Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig6461  (registered. 2007)
Contig Information
Length 210 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os06g0101600 [Oryza sativa (japonica cultivar-group)] >gi|122168719|sp|Q0DFC9|PLAS_ORYSJ RecName: Full=Plastocyanin, chloroplastic; Flags: Precursor >gi|152032655|sp|A2Y886|PLAS_ORYSI RecName: Full=Plastocyanin, chloroplastic; Flags: Precursor >gi|3885896|gb|AAC78108.1| plastocyanin precursor [Oryza sativa] >gi|55296746|dbj|BAD67938.1| plastocyanin, chloroplast precursor [Oryza sativa Japonica Group] >gi|113594570|dbj|BAF18444.1| Os06g0101600 [Oryza sativa (japonica cultivar-group)] >gi|125553691|gb|EAY99296.1| hypothetical protein OsI_21262 [Oryza sativa Indica Group] >gi|215697765|dbj|BAG91958.1| unnamed protein product [Oryza sativa Japonica Group] (no hit)
Score 465
Evalue 3.59346e-45
Total Hit Count 0
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig6461
GCCAGCTAGAGTTTCAGCATTGTAAATCTTGTACTGTTCTATAAAACCTTCACTCTGTCCCTTCTGGACCACATACCACATATCCGTACTCAAAGTTACA
TCTTATTTTTGCTTGTTCTTGCGCTTGTCGTAGAAGTGCAAGAGTGTCGTGTACTTTATATGTAACTTCTAAATTATCATTGTAATTTAGTTTTCCTTAT
AAAAAAAAAA
page-top