Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1015  (registered. 2012)
Contig Information
Length 1006 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_DPA20 Seed DPA20 2
WH_XC Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|11037530|gb|AAG27621.1|AF286317_1|AF286317_1 starch branching enyzyme 1 [Triticum aestivum]
Score 531
Evalue 5.00E-149
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig1015
TGGGATGGAAGCCCGAAACTTTCTTTATGACAGAGGACTCGGGATGGCGCATATTTGGCACATATAGCTGGACTCGACCCGCACCATCACCGCTTATTTA
TCTTTCTATATAGTAGGTAACCTCAGCAAAGTCCAAGCCAGAATCTCAAGTCTGCACAGTTTGACAGTATTGCTACTACTAGCAATAGCAGGAGTATTAC
AAGGACGTCGGCACACGGTCCTGATCAAGCGTTGATATGGTGCTTATTTGTTGTCTTTGTCGGGTGACAGAAAGACAAAGTTAATTCCCTTCTTGCTGGA
GTCACCTCCTGTAGACGCCTTTTCGGAACCAGAAGTCGCCTCACCATCTGCTGCGTCTTTGACGCCAGTGGCTTCAACATCGATGTACCCGAGAGCAGTT
TTCCCCCAAGAAGCAGCTCCTTCATCCTTGGGCTTTTCCGCTTTCTCCTCGACGCGATAGTAAGCCACACAAGTGCGGGATGGAGACAGGATTTTGAATG
AGTTAGGGCGGTTGTTGAAGTTTGTTTCAGGTACTCCTGGTACTCCTTCAGGTGACGTAAAGTGATCGTTGTCATGGGCCACTCTTCCATGTCCACCAAA
CATCAGAGCATCAGAGTCCAGAGCTACCTTGTACTTCCCAGGCAAGTCACATCCGACTTTGTAACCATCATAAGTTTTACTGGGATGAAAATTGAAGACG
AAGACCAGATCTCCACGTTCAAATACAATAATCTTCTTTTCCTCATTCATGTCGCTGACAATCTGCTTTGATGATGATAGGAAGGAAAATTTGTCGTCGA
GCGCATTCATTGCTTGATCAAATGCGTTCATGTACTTGTATCGTAGGTGATCAATGTCTGCGAGGCTCCACTGGCGTCTGCATTTATCATAACTCCAGTT
GTTGCCTTCTCTTGGAAAGTCAATCCATTCTGGGTGGCCAAACTCATTACCCATAAAATTCAAGTAGCCATCACCTCCAAGGGCCATGGTGATGAAGTGA
ATCATC
page-top